ID: 921188601

View in Genome Browser
Species Human (GRCh38)
Location 1:212690734-212690756
Sequence CTCAAACCCTCCCATGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921188601_921188607 10 Left 921188601 1:212690734-212690756 CCTTTGCCATGGGAGGGTTTGAG 0: 1
1: 1
2: 0
3: 13
4: 154
Right 921188607 1:212690767-212690789 TCCCTCTCTGGGTATTTGTCGGG 0: 1
1: 0
2: 1
3: 16
4: 191
921188601_921188604 -2 Left 921188601 1:212690734-212690756 CCTTTGCCATGGGAGGGTTTGAG 0: 1
1: 1
2: 0
3: 13
4: 154
Right 921188604 1:212690755-212690777 AGGTTGCTGTGCTCCCTCTCTGG 0: 1
1: 0
2: 0
3: 23
4: 140
921188601_921188605 -1 Left 921188601 1:212690734-212690756 CCTTTGCCATGGGAGGGTTTGAG 0: 1
1: 1
2: 0
3: 13
4: 154
Right 921188605 1:212690756-212690778 GGTTGCTGTGCTCCCTCTCTGGG No data
921188601_921188606 9 Left 921188601 1:212690734-212690756 CCTTTGCCATGGGAGGGTTTGAG 0: 1
1: 1
2: 0
3: 13
4: 154
Right 921188606 1:212690766-212690788 CTCCCTCTCTGGGTATTTGTCGG 0: 1
1: 0
2: 1
3: 38
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921188601 Original CRISPR CTCAAACCCTCCCATGGCAA AGG (reversed) Intronic
903844534 1:26270346-26270368 CTCAGAACCTGTCATGGCAATGG - Intronic
903963342 1:27071004-27071026 CTCACACCCAGCCATGACAAGGG - Intergenic
904102377 1:28042574-28042596 TTCAAACCTTCCCATGTCAGAGG - Exonic
904998316 1:34648474-34648496 CTCAAGCCCATCCATGGCAGCGG - Intergenic
909456348 1:75853975-75853997 CTAAAACCCTCTCATGGCTAGGG + Intronic
909578314 1:77202019-77202041 CTGTAACCCACCCAGGGCAATGG + Intronic
910920241 1:92338329-92338351 CTCAAATCCTCTTTTGGCAAAGG - Intronic
912628377 1:111225340-111225362 CTCAAACCCCACCATGGAAGAGG - Intronic
915581529 1:156815938-156815960 CTCCCACCCTCCCATGGGGAAGG - Intronic
915654551 1:157348499-157348521 CTCACAGCCTCCCTTGGCTAGGG + Intergenic
917081575 1:171261401-171261423 CAAAAACCCTGCCCTGGCAATGG + Intronic
918338919 1:183551039-183551061 GCCAAACCCACCCATGGCTAAGG - Exonic
920193690 1:204212160-204212182 CTCAACCCTTCCCATTGCACAGG + Intronic
920450789 1:206059708-206059730 CTTAAACCCTCCCATTGTATAGG - Intronic
920769821 1:208872205-208872227 CTAAACCCCTCACTTGGCAATGG - Intergenic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
921532509 1:216302075-216302097 CTCTAATGTTCCCATGGCAAAGG + Intronic
921962169 1:221047347-221047369 CTCATGGCCTCCCATGGCTAGGG - Intergenic
924569544 1:245225711-245225733 CTCAAACCCTTCCATCCCTACGG - Intronic
1065106211 10:22388825-22388847 CTGAAACCCCCCCATCACAATGG - Intronic
1076434833 10:130433180-130433202 CCCAGACCCTTCCTTGGCAATGG - Intergenic
1077123609 11:922489-922511 CTCCCACCCTTCCATGGCAGGGG + Intergenic
1078445649 11:11403169-11403191 CTCAAAGCCTCCCACAGGAAGGG + Intronic
1085277184 11:75307707-75307729 CTCACACCCTCCCCTGCCCAGGG + Intronic
1085841107 11:80012764-80012786 CTCTAGCCCAGCCATGGCAAGGG - Intergenic
1091695656 12:2626435-2626457 TTCAAGCCCTCCCATAGCAAAGG + Intronic
1092719858 12:11431148-11431170 CTCAAATCCTACTATGGAAATGG + Intronic
1092782496 12:11999939-11999961 ATCAAACCCACCCAAGGAAAAGG - Intergenic
1094463079 12:30719162-30719184 TCCAAATCCTCCCATGGCAAAGG - Intronic
1094494681 12:30982041-30982063 CCCAGACCCGCCCATGGCACTGG - Intronic
1098917117 12:76269137-76269159 CTAAAACCCTACCTTGCCAAGGG + Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102995872 12:117350272-117350294 CACACATCGTCCCATGGCAATGG - Intronic
1107213650 13:37889144-37889166 CCCAAACACTTCTATGGCAATGG - Intergenic
1108144287 13:47460660-47460682 CTCAAACCATCTCTGGGCAAAGG - Intergenic
1110337092 13:74345498-74345520 CTGAAACCCTGCCATGGGGAGGG + Intergenic
1111782101 13:92741353-92741375 CTCAGAGCCTCCCACGGCAAAGG - Intronic
1113542940 13:111123041-111123063 CTCCAACCCTCCCATGCCCCTGG + Intronic
1117146353 14:52840324-52840346 CTCAAACCATCCAAAGGCCATGG - Intergenic
1118777385 14:68981240-68981262 CTGAAAGCCACCCATGGAAAAGG + Intergenic
1120425370 14:84341125-84341147 CTCAGACCATTCCTTGGCAATGG + Intergenic
1120941957 14:89957457-89957479 CTCAAACCCGGCCATGACTAGGG - Intronic
1121482817 14:94291630-94291652 CCCAGACCCTCCCAGGGCAGTGG - Intronic
1122308284 14:100779171-100779193 GCCACACCCTCCCATGGCAGGGG - Intergenic
1130692191 15:86092264-86092286 CTCAAACAATCACATGGCATAGG - Intergenic
1132023236 15:98382777-98382799 CTCCATCCTTCCCATGGCCAGGG + Intergenic
1132296453 15:100738318-100738340 CTCAAACCCTCCAATCGGCAGGG - Intergenic
1133128946 16:3664528-3664550 CGCAAACCCTCCGATGCCCATGG + Exonic
1137466068 16:48710952-48710974 CTCAAACCCTCCCAGGGGCCAGG + Intergenic
1139370079 16:66461655-66461677 CTGCAACCCTGCCATGGCCAGGG + Intronic
1139551983 16:67678808-67678830 CTGAATCCCTCCCTTGGCGATGG - Intronic
1141425333 16:83941066-83941088 CACAAAGACTCCCATGGGAACGG + Intronic
1143270508 17:5671591-5671613 ATCAAACCCTGCCATGGCTTAGG + Intergenic
1144286046 17:13775612-13775634 TTCAAAGCCACCCATGGCACAGG - Intergenic
1148623973 17:49054862-49054884 CTCAGACTCCCCCAGGGCAAAGG - Exonic
1150439536 17:65179912-65179934 ATCACACCCCACCATGGCAAAGG - Intronic
1151936505 17:77265228-77265250 CCCAACCCCACCCATGGCACGGG + Intergenic
1152128395 17:78461171-78461193 CTCAACCCCTCCCATGCTCACGG + Intronic
1155661726 18:28257276-28257298 CTGTAACACTCCCATAGCAAAGG - Intergenic
1157307888 18:46530252-46530274 CTCACTCCCTCCCAGGACAAGGG - Intronic
1157780848 18:50437730-50437752 CTCAGACGCTGCCCTGGCAAGGG + Intergenic
1166270673 19:41711595-41711617 TGAAAACCCTCCCATGGCCAAGG - Intronic
1166423648 19:42657014-42657036 TGAAAACCCTCCCATGGCCAAGG - Intronic
925718150 2:6803688-6803710 CTCAAGCCCTCCCTGGGGAAGGG - Intergenic
928353204 2:30582209-30582231 CTGCCCCCCTCCCATGGCAATGG + Intronic
931886764 2:66626204-66626226 CTCAAGGCTTCCCTTGGCAAGGG + Intergenic
933769794 2:85735866-85735888 AACAATCCCTCCCATGGGAAGGG - Intergenic
934750114 2:96788715-96788737 CTCAGGCCCTCCCATGGGAGAGG - Intronic
935325769 2:101935582-101935604 CTCACACCCTCCCTTGGCTAGGG - Intergenic
936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG + Intergenic
936191896 2:110340612-110340634 CTCACACTCTCCCATGGCTGGGG - Intergenic
939937832 2:148313867-148313889 CTCAATCCTTCCCGTGGCTAAGG + Intronic
940306073 2:152228061-152228083 CTCAAACCCTCCCCTCTCAGAGG - Intergenic
941682403 2:168413271-168413293 CTCACAGCCTCCCTTGGCTAGGG + Intergenic
941844184 2:170117314-170117336 ATCAAACCATACCATGGCATGGG + Intergenic
942230061 2:173852613-173852635 CTCAATCCCTACCATGTCATTGG + Intergenic
943055210 2:182968849-182968871 CTCAAACCCTACCATGGCAAGGG + Intronic
945266081 2:207892687-207892709 CTCCACCCCACCAATGGCAATGG - Intronic
946596171 2:221308123-221308145 CTCAAACCATCCGTTGGCATAGG - Intergenic
947588192 2:231370013-231370035 CTGGAACCCACCCAAGGCAAAGG + Intronic
948241108 2:236435715-236435737 CTCAAATCCCCACATGTCAAGGG - Intronic
948741917 2:240053908-240053930 CTCAAGACCTCCCCTGGCCATGG + Intergenic
1171391279 20:24803085-24803107 GACAAACCGTCCCATGGCCATGG + Intergenic
1175134200 20:56810649-56810671 CTCAAACCAATCCCTGGCAAGGG - Intergenic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1178371009 21:32027676-32027698 CTCAAAGCTTCCAATGACAAGGG + Intronic
1178818551 21:35953963-35953985 CCCAAACCTGCCCCTGGCAATGG + Intronic
1179097716 21:38330500-38330522 CTCAAGACATCACATGGCAAGGG - Intergenic
1179318889 21:40271003-40271025 CTCAAGCCCTGCCATTGCCAGGG - Intronic
1180053975 21:45347694-45347716 CTCAGACCCTCTCGTGGCAGTGG - Intergenic
1181100628 22:20536626-20536648 CTCAGTCCCTCCCAAGGCAAGGG - Intronic
1182300891 22:29336325-29336347 CTAGAACCCTCCCATGACCAAGG + Intronic
1183371428 22:37434730-37434752 CACAAACCCTCCCTTTGCCATGG - Intergenic
1184301762 22:43565006-43565028 CACAAAGCCCCCCCTGGCAAAGG - Intronic
1184900521 22:47443957-47443979 CTCAAACCCACCCATGGGGTCGG + Intergenic
949416016 3:3814703-3814725 CTCACATCCTCACATGGCAGAGG - Intronic
950104782 3:10381170-10381192 CCCATGGCCTCCCATGGCAAAGG + Intronic
950161407 3:10763886-10763908 CTGATACCTTCCCAAGGCAAAGG + Intergenic
953180421 3:40589653-40589675 CCCCAATCCTCCTATGGCAAAGG - Intergenic
960523347 3:118681156-118681178 CTCACTCCCTCCCATGAGAATGG - Intergenic
960813333 3:121647356-121647378 CCCAAAGCATCCCATGGCTATGG - Exonic
964419680 3:156488363-156488385 CTCAAACCCTACCTTCTCAATGG - Intronic
965656020 3:170985792-170985814 CTCACACTCTCCCATTGGAAAGG + Intergenic
968059256 3:195714507-195714529 CTCAAACCCACCACTGGCACTGG + Intergenic
969162847 4:5276419-5276441 ATGAAACCCTTCCATGGCAAGGG - Intronic
969902121 4:10359735-10359757 CTCAAATACTCCAATGGGAAGGG - Intergenic
969915982 4:10492174-10492196 CTCAGAGTCTCCCATGGCTAGGG + Intronic
978669668 4:111231732-111231754 CTCAAACCCTCCCATTTATATGG - Intergenic
979421328 4:120509021-120509043 CTCAAAGCTTCCCTTGGCTAGGG - Intergenic
979457531 4:120943987-120944009 CTCAAGGCTTCCCTTGGCAAGGG - Intergenic
979787823 4:124738885-124738907 CTCAAACAGTCCTATGGAAAGGG - Intergenic
984943530 4:184953941-184953963 ATCAAGCCCTCCCATCTCAAGGG - Intergenic
985155462 4:186983037-186983059 AACAAACCCTCCAAAGGCAAGGG - Intergenic
985779646 5:1863511-1863533 CTCAGGTCATCCCATGGCAAGGG - Intergenic
989724257 5:44569339-44569361 CAGAAACTCTCACATGGCAAAGG + Intergenic
990955500 5:61334262-61334284 CTCAAACATTCCCATCGCTATGG - Intronic
991191355 5:63878069-63878091 CTCACACCCTCACAAGGCAAGGG + Intergenic
991575012 5:68093569-68093591 TTTAAAGCCTCCCATGGCAGTGG + Intergenic
993061396 5:83043023-83043045 CTCAAACCATCCCATGGCCTTGG + Intergenic
995474971 5:112538864-112538886 CTCAAAGCTTCCCTTGGCTAGGG - Intergenic
999619960 5:153462817-153462839 CTCACTCCCTGCCATGTCAAGGG + Intergenic
1000323862 5:160157142-160157164 GGCAAACCCTGCCATGGCAGGGG - Intergenic
1000575523 5:162970620-162970642 CTTAAATCCTCACATGTCAAGGG + Intergenic
1001488093 5:172134318-172134340 CTCAAACCATCTCTTGGTAAAGG - Intronic
1005362253 6:25041944-25041966 CTAAAACCTGCTCATGGCAAAGG + Intronic
1007246583 6:40467700-40467722 CTCAGAACCTCCCATGGCCGAGG - Intronic
1012433246 6:99188208-99188230 TTGAAAACCTCCAATGGCAATGG + Intergenic
1017473683 6:154766404-154766426 CACAAACCCTCCTATGACACAGG - Intronic
1018474689 6:164129112-164129134 CTCAAATCTTCCCCAGGCAATGG + Intergenic
1019370451 7:660364-660386 TACAATCCCTCCCATGGCACAGG + Intronic
1021591548 7:22269090-22269112 CTCGTATCCTCCCATGGCAGAGG - Intronic
1031053516 7:116969686-116969708 TTCAAAGCCTCCCATAACAAAGG + Intronic
1033710256 7:143935543-143935565 CTCAATCCCACCCAAGGCCAGGG - Exonic
1033712280 7:143960281-143960303 CTCAATCCCACCCAAGGCCAGGG - Exonic
1034020543 7:147637145-147637167 CTCAAAGCCTTCAATGGCAGCGG - Intronic
1034517242 7:151590518-151590540 CTCCGAGCCTCCCATGGCAGTGG + Intronic
1035768911 8:2130886-2130908 ATCAAACCTTCCCCTGGAAAAGG + Intronic
1036985216 8:13521425-13521447 CTCTAAGCCAACCATGGCAAGGG - Intergenic
1039723964 8:40195219-40195241 CTCTGACCCTCCCATGTTAAAGG - Intergenic
1042473935 8:69223706-69223728 CTTAACCCCTCCCAGGCCAATGG + Intergenic
1042627229 8:70771140-70771162 CTCAAAGCTTCCCTTGGCTAGGG + Intronic
1043309262 8:78837959-78837981 TTAGAACCCTCCTATGGCAATGG - Intergenic
1044119008 8:88370913-88370935 CACACACCCACCCATGGCCAGGG - Intergenic
1046034042 8:108820239-108820261 CTCCAACCTTCCCATGGAACTGG - Intergenic
1047366394 8:124215550-124215572 CTCAAACCCTGCCAGGGGAAGGG - Intergenic
1048546732 8:135394620-135394642 GTAAAAACCTCCCATTGCAAGGG + Intergenic
1049302644 8:141879741-141879763 CTGAGACCATCCCATGGCAAGGG - Intergenic
1050111332 9:2219668-2219690 CTCAAACCATGCCATGATAATGG - Intergenic
1050271769 9:3953501-3953523 CTCAAACCCTCACTTTACAAGGG - Intronic
1052169174 9:25372618-25372640 CTCAATCTCACCAATGGCAACGG - Intergenic
1052272122 9:26637851-26637873 CTCAAACTATCCCAAGTCAAAGG + Intergenic
1052564173 9:30125864-30125886 TTCAGACCATCACATGGCAAAGG - Intergenic
1057634732 9:96753739-96753761 TTCAATCCCTCAAATGGCAAGGG - Intergenic
1058465938 9:105227465-105227487 CTGATAGCCTCCCATGGCAAGGG + Intergenic
1058924485 9:109648976-109648998 CTCAGACCTTCCCAGAGCAAGGG - Intronic
1058937757 9:109784860-109784882 CTCAAGCTTTCCCATTGCAATGG - Intronic
1061059223 9:128242399-128242421 CTCAGACCCTCCCATGGGCTTGG + Intronic
1186193847 X:7092725-7092747 CTCAAACCTGCCCATGACACTGG + Intronic
1187784246 X:22866593-22866615 CTCACACCTTCCCTTGGCTAGGG - Intergenic
1188146005 X:26614518-26614540 CTCAAACTCTCCCATTTCAGGGG - Intergenic
1191849023 X:65571942-65571964 CTCAGACCTTCCCTTAGCAAAGG + Intergenic
1193034412 X:76934140-76934162 CTCACAGCTTCCCTTGGCAAGGG - Intergenic
1197297919 X:124741927-124741949 CTCAAACATCCCAATGGCAAAGG + Intronic
1197476807 X:126935150-126935172 CTCAAACTGTCACATGGTAAAGG + Intergenic
1199810863 X:151347173-151347195 CTCAAGCCCTCACAGGGCAAGGG + Intergenic
1201565801 Y:15364408-15364430 CTGAAACCTGCCCATGACAATGG + Intergenic
1201860383 Y:18591371-18591393 CTCAAAACAACCCAGGGCAAGGG - Intergenic
1201872940 Y:18729010-18729032 CTCAAAACAACCCAGGGCAAGGG + Intergenic
1202095387 Y:21244002-21244024 CTCAAAACAACCCATGGCAGGGG - Intergenic