ID: 921191012

View in Genome Browser
Species Human (GRCh38)
Location 1:212708742-212708764
Sequence AACTGCCTGTGGAAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921191012_921191023 29 Left 921191012 1:212708742-212708764 CCATCCAACTTCCACAGGCAGTT No data
Right 921191023 1:212708794-212708816 GGAGCCCAGGATTCCCCAAGGGG No data
921191012_921191015 8 Left 921191012 1:212708742-212708764 CCATCCAACTTCCACAGGCAGTT No data
Right 921191015 1:212708773-212708795 ACTCCCTGAAGCTGTGTCCCTGG No data
921191012_921191021 27 Left 921191012 1:212708742-212708764 CCATCCAACTTCCACAGGCAGTT No data
Right 921191021 1:212708792-212708814 CTGGAGCCCAGGATTCCCCAAGG No data
921191012_921191022 28 Left 921191012 1:212708742-212708764 CCATCCAACTTCCACAGGCAGTT No data
Right 921191022 1:212708793-212708815 TGGAGCCCAGGATTCCCCAAGGG No data
921191012_921191018 16 Left 921191012 1:212708742-212708764 CCATCCAACTTCCACAGGCAGTT No data
Right 921191018 1:212708781-212708803 AAGCTGTGTCCCTGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921191012 Original CRISPR AACTGCCTGTGGAAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr