ID: 921193804

View in Genome Browser
Species Human (GRCh38)
Location 1:212732958-212732980
Sequence TCTTGGTATTCCTCAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921193799_921193804 -10 Left 921193799 1:212732945-212732967 CCATTCCAATTCCTCTTGGTATT 0: 1
1: 0
2: 2
3: 32
4: 323
Right 921193804 1:212732958-212732980 TCTTGGTATTCCTCAGGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921193804 Original CRISPR TCTTGGTATTCCTCAGGTCT GGG Intronic
902304968 1:15529764-15529786 TCTTGATATCCATGAGGTCTTGG + Intronic
903417580 1:23194492-23194514 TCTTGGGATTCCTGTGGTTTAGG - Exonic
903886500 1:26543929-26543951 TCTGGGTCCCCCTCAGGTCTTGG + Intronic
903970435 1:27115304-27115326 TTTTGCTACTCCTCAGCTCTGGG - Intronic
904419539 1:30382754-30382776 CCTGGGTGTTCCTCAGGACTGGG - Intergenic
905488875 1:38328047-38328069 TCTTGGCAGTCCCCAAGTCTCGG + Intergenic
906186726 1:43867825-43867847 TATTGGTATTCCTCAGAGTTAGG - Intronic
906707136 1:47903111-47903133 TCTTGGGCTTCCTCTGGTCATGG + Intronic
908003850 1:59708417-59708439 GCCTGGTATTCCCCTGGTCTAGG - Intronic
911486179 1:98508712-98508734 TCTTTGTATTTCTGTGGTCTCGG - Intergenic
911574717 1:99561866-99561888 TGTTGGTTTTCTTCATGTCTTGG - Intergenic
917032658 1:170711186-170711208 TCTTGGTGTTACTCTGGTCTTGG - Intronic
917581209 1:176379823-176379845 TCTTGGCATTCCTTCGGTTTCGG + Intergenic
918290263 1:183100569-183100591 TCTAAGCATTCCTCATGTCTTGG + Intronic
919369469 1:196705621-196705643 TCATGATATTCCCCAAGTCTTGG - Intronic
919382042 1:196871669-196871691 TCATGATATTCCCCAAGTCTTGG - Intronic
919612252 1:199759770-199759792 TCTTAGCATTCCTCAGATTTGGG - Intergenic
920743791 1:208606455-208606477 TTTTAGTATTCCTTAGGGCTTGG + Intergenic
921193804 1:212732958-212732980 TCTTGGTATTCCTCAGGTCTGGG + Intronic
1062775958 10:148114-148136 TATTGGTATTCCTCCAGGCTGGG + Intronic
1063432374 10:6001804-6001826 CCTTGGTGTTCCTCAGCTCGTGG + Intergenic
1065141469 10:22722666-22722688 TCTTCTAATTCCTCTGGTCTTGG - Intergenic
1067812929 10:49444397-49444419 TGTTGGTTTTCTTCAGATCTTGG - Intergenic
1068755345 10:60646678-60646700 TGTTGGGGTTCCTCAGGTCACGG - Intronic
1069402803 10:68067192-68067214 TCTTGAAATTCCTCAGATGTAGG + Intronic
1069660165 10:70118138-70118160 TATTGGTAGTCCTCTGGCCTGGG - Intronic
1070170889 10:73932049-73932071 CATTGGTGCTCCTCAGGTCTAGG + Intergenic
1070753592 10:78977905-78977927 TCCCGGAATTCCTCAGGGCTGGG + Intergenic
1071547072 10:86536992-86537014 ACTTGGGCTTCCCCAGGTCTTGG + Intergenic
1073622745 10:105066008-105066030 TCATGGTATTTCTAGGGTCTTGG - Intronic
1074962634 10:118461884-118461906 TCTTGGTCTTCCTCTTGGCTGGG - Intergenic
1075310088 10:121406522-121406544 GCTTCTTATTCCTCAAGTCTTGG - Intergenic
1075355692 10:121772122-121772144 TCTTTGTATCCCTGATGTCTGGG - Intronic
1080499504 11:32855748-32855770 TCTTGCTATTCCTTGTGTCTTGG + Exonic
1081982986 11:47281559-47281581 TCTTGTTGTTCCACAGGCCTTGG + Exonic
1082885484 11:58077817-58077839 TCCTGATAGTCCTCAGGTGTAGG + Intronic
1084333036 11:68440726-68440748 TCTGGGTATCCCTCACATCTGGG + Intronic
1085510110 11:77083893-77083915 CCTTGGTTTCCCTCAGGGCTGGG + Intronic
1086019464 11:82209271-82209293 TCTTGGTGTTCCTAAGTGCTGGG - Intergenic
1086665033 11:89469904-89469926 AGTTGTTATTCCTTAGGTCTCGG + Intronic
1089057170 11:115595080-115595102 TCTAGTTTTTCCTGAGGTCTGGG - Intergenic
1091697735 12:2639259-2639281 TCTTGCTCTTCCTCAGTGCTTGG + Intronic
1092085545 12:5756171-5756193 TCATTGTATTCTTCAGTTCTAGG + Intronic
1095818209 12:46448242-46448264 TGTTGGCATGCCTCAGGTCCTGG + Intergenic
1098100735 12:67013878-67013900 ACTTGGAATTCTTCAGGCCTTGG + Intergenic
1099002272 12:77192837-77192859 TCTTGGTACTTCTCAGTTTTAGG - Intergenic
1101728244 12:107405604-107405626 ACTTGGAAATCCTCAAGTCTGGG + Intronic
1101942520 12:109110598-109110620 TCTTGTTATTCCTTGGGTGTTGG + Exonic
1102686649 12:114729985-114730007 TCTTGGGATTCTTCAAGTCATGG + Intergenic
1104077963 12:125407188-125407210 TCTTTGTTTACCTGAGGTCTTGG - Intronic
1104493650 12:129216502-129216524 TCTTGATATTCCTCAGCTTACGG - Intronic
1105358544 13:19683996-19684018 ATTTGGTATTTTTCAGGTCTGGG - Intronic
1107487398 13:40842381-40842403 GCTTGGTATTGGTCAGGTCAGGG - Intergenic
1108306442 13:49140080-49140102 TCTTGGTTTTCCAAAGGACTGGG - Intronic
1108636112 13:52335933-52335955 TCTTTGTATACCTCGGGCCTTGG - Intergenic
1108651699 13:52487317-52487339 TCTTTGTATACCTCGGGCCTTGG + Intergenic
1109337595 13:61012286-61012308 TCCTGGCATTGCTCAGATCTTGG - Intergenic
1110722702 13:78782830-78782852 TCTTGATATTCATCTGTTCTTGG + Intergenic
1111108045 13:83671705-83671727 TCTTTTTATTCCACTGGTCTTGG - Intergenic
1111119622 13:83829995-83830017 TCCTGGTTATCCTCAAGTCTTGG - Intergenic
1113735416 13:112674956-112674978 TGTTGTTATTCCTGAGGACTTGG - Intronic
1115004681 14:28468047-28468069 TCTGGGTATTAATCAGGTGTCGG + Intergenic
1115271379 14:31557249-31557271 TCTTTGTCTTCCTCAGCTTTTGG + Intronic
1115755274 14:36522281-36522303 TCTTCCTTTTACTCAGGTCTTGG - Intergenic
1118256906 14:64213252-64213274 TTTAAGTATTCCTCAGGGCTGGG + Intronic
1119444568 14:74652619-74652641 TCCTGGTAGCCCACAGGTCTTGG + Intergenic
1125235974 15:37514149-37514171 TCTTGGTTTTCCTCAGTGCTTGG + Intergenic
1125827458 15:42688562-42688584 GCAAGGTATTACTCAGGTCTTGG - Exonic
1126225423 15:46263290-46263312 TCTTTGCAATCCTCAGGTCAGGG - Intergenic
1126286608 15:47019762-47019784 TCATTGTATTCTTCAGATCTAGG - Intergenic
1128291535 15:66482046-66482068 TCTTGGTCTTTCTTAGGCCTTGG + Intronic
1129133750 15:73527189-73527211 TCCTAGAATTCCACAGGTCTGGG - Intronic
1131776445 15:95805649-95805671 TCTTTGTATTTATCATGTCTGGG - Intergenic
1134404606 16:13945381-13945403 ACTTGGAATTCAGCAGGTCTTGG - Intronic
1135881908 16:26265795-26265817 TCTTGGAAATACTCAGGTCAGGG + Intergenic
1136000124 16:27286140-27286162 TCTTGTTCTTCCTCAGGCTTGGG + Intronic
1137938702 16:52659654-52659676 TCTTTGAATTCTTCAGCTCTAGG - Intergenic
1140529908 16:75656264-75656286 TCTGAGTCTTCCTCAGGTGTGGG - Exonic
1141707533 16:85675923-85675945 GCATGGTCTTCCTCAGGTCAAGG - Exonic
1144380830 17:14696313-14696335 TCTTGGTATCTGTCAGGTATAGG - Intergenic
1147480764 17:40760842-40760864 TCATTGTATTCTTCAGGTCTAGG + Intergenic
1148024123 17:44573866-44573888 TCTTGTTATTCCTCAGTTTCTGG + Intergenic
1148030164 17:44614275-44614297 TCTATTTATTCTTCAGGTCTCGG + Intergenic
1148606842 17:48936081-48936103 TCTCCCTATTCCTCATGTCTAGG - Intronic
1148847421 17:50537637-50537659 TCTGAGTATTCCTCAGATCCTGG - Intronic
1151279809 17:73064940-73064962 TCTTGGTGTTCCTCAGGCAGGGG - Intronic
1151407699 17:73900147-73900169 CCTTTGCTTTCCTCAGGTCTTGG + Intergenic
1153817146 18:8800340-8800362 TCACAGTATTCCTCAGGCCTTGG + Intronic
1159402512 18:67956278-67956300 TCCTTGTATTTCTCATGTCTGGG - Intergenic
1161772088 19:6236413-6236435 TCTTGGGAAGCCCCAGGTCTTGG + Intronic
1162182949 19:8883107-8883129 TCTTAATATTTCTCAAGTCTGGG - Intronic
1162304649 19:9864627-9864649 TCTTGCTGTCGCTCAGGTCTGGG + Intronic
1162797168 19:13092819-13092841 TCTGGGGATGCCTCAGGCCTGGG + Intronic
1163225894 19:15961029-15961051 TCTGGGTGTTCCTAGGGTCTAGG - Intergenic
1165141803 19:33704246-33704268 TCCTGGCATTCCTCAAGTCCTGG + Intronic
926952307 2:18255437-18255459 TTTTAGTATTCCTCAGCACTTGG + Intronic
927142388 2:20139394-20139416 TCTTGGACTTCCCCAGGTCAGGG - Intergenic
929705005 2:44201328-44201350 TGTAGGTATTCCTCACGGCTTGG + Exonic
935145273 2:100391209-100391231 TCTGGGCGTTCCTCAGGACTGGG - Intergenic
935793521 2:106616293-106616315 TCTTGGTTTTTTTCAGGTGTCGG + Intergenic
935854230 2:107257514-107257536 TCTTGGGATTCCTCATGAATGGG + Intergenic
936523571 2:113227688-113227710 TCTTGGTACTCCTCAGAGCCGGG - Intronic
942607107 2:177704160-177704182 TCTTTGTATTCCACATGCCTGGG - Intronic
943099955 2:183475577-183475599 TGTTGGTATTCCTTAAGCCTTGG + Intergenic
943346506 2:186744497-186744519 TCTTGGTATTTCAAATGTCTTGG - Intronic
948739767 2:240036890-240036912 TCTTTGTATTTCTGTGGTCTCGG + Intergenic
1169668977 20:8073516-8073538 TCAGGGTATTACTCAGGGCTGGG - Intergenic
1169946109 20:10990790-10990812 ATTTGGGATTCCTCAGGCCTGGG - Intergenic
1171240335 20:23562766-23562788 TCTTGGATTTCCCCAGGGCTAGG - Intergenic
1178870294 21:36368330-36368352 TCTTTGTATTCTTCAGCTCAGGG - Intronic
1179120826 21:38544173-38544195 TCTTGGTATTCCTCACCCCAGGG - Intronic
1181946869 22:26524892-26524914 TCTTTGTATACCTCAGGCCTTGG + Intergenic
1182295587 22:29309835-29309857 TCTGGGCCTTCCCCAGGTCTAGG + Intronic
1182398432 22:30054905-30054927 TCTTTGTATGCCTGAGGCCTTGG - Intergenic
1183023620 22:35047314-35047336 TCTCTGTATCCCTCAGCTCTCGG - Intergenic
949908854 3:8883295-8883317 TTTTGGTATTTCTCATGACTGGG - Intronic
950434199 3:12968686-12968708 TCTAGGCATTCCACAGGTGTGGG - Intronic
951887201 3:27536063-27536085 TCTTGGTATTCCAAAGAGCTGGG - Intergenic
952277801 3:31894336-31894358 TGTTAGAATTCCTCAAGTCTTGG - Intronic
952581399 3:34837657-34837679 TCTAGGCATTTCTCAGATCTAGG + Intergenic
957438715 3:80214363-80214385 TCTTGTTATTTCTCTGGACTCGG + Intergenic
959146546 3:102552675-102552697 TCTTGGTTTCTCTCAGGTGTTGG - Intergenic
960180649 3:114572443-114572465 TCTTTGTATACCTCAGGTTCTGG - Intronic
964138166 3:153368714-153368736 TCTTACTTTTCCTTAGGTCTGGG + Intergenic
964280102 3:155054586-155054608 CCTTGGTGATCCTCAGGCCTTGG - Intronic
964409547 3:156383525-156383547 CCTAGGAATTCCTCAGTTCTGGG + Intronic
966380876 3:179343818-179343840 TCTTTGTATTCCTGAGCACTTGG - Intergenic
966395011 3:179493405-179493427 TCATTGTATTCCTCAGTTCTAGG - Intergenic
966475233 3:180336946-180336968 TTTTGATATTACTCAGGTGTGGG + Intergenic
966589398 3:181664177-181664199 TCCAGGTATTCCTCAGGTAGTGG - Intergenic
968669930 4:1843767-1843789 TCTAGGTTCTCCTCAGCTCTGGG + Intronic
974372177 4:61031818-61031840 TCTTGGTATCCATGAGGACTTGG + Intergenic
975303294 4:72817407-72817429 TCTTTATATTCCTAAGGCCTAGG - Intergenic
975696824 4:77021912-77021934 TCTTGGTATGCCCCTTGTCTGGG - Intronic
977091373 4:92680752-92680774 ACTTGCCATTCCTCATGTCTGGG - Intronic
978144932 4:105361745-105361767 TAATGGTATTCCTTAGTTCTAGG - Intergenic
982937455 4:161500128-161500150 TGTTTTTATTCCTAAGGTCTGGG - Exonic
983327952 4:166284216-166284238 TCTTTGTATTCCTCAAGACTTGG - Intergenic
984984177 4:185311492-185311514 TCTTAGTATGCTCCAGGTCTTGG - Intronic
986236646 5:5916727-5916749 CCTGTGTATACCTCAGGTCTGGG + Intergenic
986323405 5:6652356-6652378 TCTGGGTTTTCCTCATGTCATGG - Intronic
990675080 5:58174983-58175005 TCTTGGCATTCCAAAGGGCTGGG + Intergenic
991559772 5:67937505-67937527 TCTTGCTATGTCTCAGGACTAGG + Intergenic
994843359 5:104953317-104953339 TCTTTGTATTTCCAAGGTCTAGG - Intergenic
997816324 5:137022231-137022253 TCTTGGGCTTCCTCAGAACTTGG - Intronic
1000105327 5:158053666-158053688 TCTGGGCATTGCTAAGGTCTAGG - Intergenic
1000812722 5:165882975-165882997 CCTTGGAATTCCTCAGGACCTGG + Intergenic
1003191032 6:3874616-3874638 TCTTGGTATCCCCCAGATTTTGG + Intergenic
1003345403 6:5261400-5261422 TCTTGGCATTCCTCAGGCCGGGG + Intronic
1004358656 6:14951850-14951872 TTTGGCTATCCCTCAGGTCTAGG + Intergenic
1010583414 6:77627474-77627496 TTTTGGAATTCCTCGGGCCTTGG - Intergenic
1011116920 6:83904205-83904227 TTTTGCTATTCCACAGGTTTTGG + Intronic
1012072044 6:94634485-94634507 TCTTCATATTCCTCATTTCTTGG + Intergenic
1012447436 6:99321176-99321198 TCTTCATATTCCTCAGCTCCTGG + Intronic
1014971040 6:127815781-127815803 TCATGCTATTCCTCAAGTCTAGG + Intronic
1016559591 6:145380304-145380326 TCTTGTTATTTCTTAGGTTTTGG - Intergenic
1018373343 6:163187899-163187921 CCTTTATATTCCTCGGGTCTAGG + Intronic
1021873708 7:25029174-25029196 TCTTGGTGGTGCTCAGCTCTGGG - Intergenic
1022104230 7:27186771-27186793 TGTTGGGAGGCCTCAGGTCTGGG - Intergenic
1023868906 7:44252324-44252346 TCTTTGTGTTCATCAGGTTTGGG - Intronic
1024917616 7:54520764-54520786 TCATTGTATTCTTCAGCTCTTGG + Intergenic
1026601525 7:71781568-71781590 TCTTTGTCTCCCTCAGGTCCAGG + Exonic
1026893512 7:73996926-73996948 TCTTTGTTTTCCTAAGGACTGGG - Intergenic
1027557514 7:79684912-79684934 TCTTGGTCTTCCTAAGCTCTAGG - Intergenic
1027838350 7:83275499-83275521 TCTTTGTATTCCTGTGGTTTTGG + Intergenic
1027923022 7:84420304-84420326 TCCTGGTTTCCCTCAGTTCTTGG - Intronic
1029584675 7:101462775-101462797 TCTCGGTGTTCCCCAGTTCTGGG - Intronic
1030013832 7:105198427-105198449 TCTTGGTAATCCCCAGGGCTTGG + Intronic
1031121141 7:117723978-117724000 TCTTGGTCTCTCTCAGTTCTGGG + Intronic
1031614562 7:123865672-123865694 TCATGGTATTTCTCAGGCCTTGG - Intronic
1035490215 7:159269975-159269997 TCATTGAATTCCTCAGCTCTAGG + Intergenic
1035918475 8:3651539-3651561 TCATGGTATTAATGAGGTCTTGG + Intronic
1037562121 8:20084423-20084445 TCTTGGTAAACCTGATGTCTAGG - Intergenic
1037861789 8:22410475-22410497 TCCTGGCAGTACTCAGGTCTGGG + Intronic
1038842283 8:31196099-31196121 TCTAGGAGTCCCTCAGGTCTGGG - Intergenic
1040868713 8:52077925-52077947 TTTTGGTATGCCTGAGGTCTTGG - Intergenic
1041000879 8:53451450-53451472 TCTTTGCATGCCTCAGGTTTTGG - Intergenic
1042648753 8:71016011-71016033 TGTTGGTATTCAACAGGTTTTGG - Intergenic
1044827681 8:96213931-96213953 TCTTGTTACTGCTCAGGTTTTGG + Intergenic
1046259953 8:111754811-111754833 TTTTGGTATCCCTCAGGAATAGG - Intergenic
1046616224 8:116480495-116480517 TCCTGGTTTCCCTCAGCTCTAGG - Intergenic
1048155009 8:131938739-131938761 TCTTTGAAGTCATCAGGTCTGGG + Intronic
1048775347 8:137939653-137939675 TCTTGGGATTTCTCATTTCTTGG + Intergenic
1049956272 9:695973-695995 TGTTTGTATTCCTCAGTACTTGG - Intronic
1050809213 9:9722240-9722262 TCTTCTTCTTCCTCAGCTCTTGG + Intronic
1050846989 9:10233561-10233583 TCTTGGTATTGCTCATAACTTGG - Intronic
1055839088 9:80481293-80481315 TTATGGTATTCTTCAGCTCTAGG + Intergenic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058931078 9:109719725-109719747 TCTAAGTATGCCCCAGGTCTAGG - Intronic
1059523341 9:114964829-114964851 TCTTGCTGTTGCTAAGGTCTGGG - Intergenic
1061161863 9:128900094-128900116 TGTGGGGATTCCTCAGGGCTGGG + Intronic
1186230204 X:7445429-7445451 TTATGGTATTGCTCAGGGCTGGG - Intergenic
1186674570 X:11803000-11803022 TCTTGCTACTTCTCAGTTCTTGG + Intergenic
1187223757 X:17355996-17356018 TATAGGAATTACTCAGGTCTGGG - Intergenic
1187588636 X:20691337-20691359 TTTTGGTATTCATTAGATCTGGG + Intergenic
1187854127 X:23620403-23620425 TCTGAGTATTCCTCATGGCTTGG - Intergenic
1187895243 X:23974377-23974399 TGTGGGAATTCCTCAGGGCTTGG + Intergenic
1187913966 X:24135654-24135676 TGTGGGAATTCCTCAGGGCTTGG + Intergenic
1188958510 X:36462945-36462967 TCTTGCTTCTCCTCATGTCTTGG + Intergenic
1189362433 X:40363137-40363159 TGTTTGTATGCCTGAGGTCTGGG - Intergenic
1190906028 X:54729312-54729334 TCTTGGAATGTCTCAGGCCTAGG + Intergenic
1194617148 X:96119453-96119475 TCTTTGTATTTCTGTGGTCTCGG - Intergenic
1196989469 X:121312142-121312164 GCATGGTATTCCTCAGGCCTAGG - Intergenic
1198534782 X:137574842-137574864 CCTTGTTATTCCTCAGTTCTGGG + Intronic
1199908588 X:152260822-152260844 TCTAGATGTTCATCAGGTCTGGG - Intronic