ID: 921193804

View in Genome Browser
Species Human (GRCh38)
Location 1:212732958-212732980
Sequence TCTTGGTATTCCTCAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921193799_921193804 -10 Left 921193799 1:212732945-212732967 CCATTCCAATTCCTCTTGGTATT 0: 1
1: 0
2: 2
3: 32
4: 323
Right 921193804 1:212732958-212732980 TCTTGGTATTCCTCAGGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921193804 Original CRISPR TCTTGGTATTCCTCAGGTCT GGG Intronic