ID: 921196195

View in Genome Browser
Species Human (GRCh38)
Location 1:212760183-212760205
Sequence GGTACCAGTGGCCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921196195_921196202 3 Left 921196195 1:212760183-212760205 CCAGCCTGTGGGCCACTGGTACC 0: 1
1: 0
2: 2
3: 16
4: 141
Right 921196202 1:212760209-212760231 GCACACTAACCAAGGGCAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
921196195_921196201 2 Left 921196195 1:212760183-212760205 CCAGCCTGTGGGCCACTGGTACC 0: 1
1: 0
2: 2
3: 16
4: 141
Right 921196201 1:212760208-212760230 AGCACACTAACCAAGGGCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 150
921196195_921196198 -5 Left 921196195 1:212760183-212760205 CCAGCCTGTGGGCCACTGGTACC 0: 1
1: 0
2: 2
3: 16
4: 141
Right 921196198 1:212760201-212760223 GTACCTGAGCACACTAACCAAGG 0: 1
1: 0
2: 2
3: 10
4: 99
921196195_921196199 -4 Left 921196195 1:212760183-212760205 CCAGCCTGTGGGCCACTGGTACC 0: 1
1: 0
2: 2
3: 16
4: 141
Right 921196199 1:212760202-212760224 TACCTGAGCACACTAACCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921196195 Original CRISPR GGTACCAGTGGCCCACAGGC TGG (reversed) Intronic
901807767 1:11748931-11748953 GGTGCCCGTGGCCCTCAGGATGG - Intronic
903472417 1:23596494-23596516 GGTACCAGTGCAACCCAGGCTGG + Intronic
903765257 1:25729904-25729926 GGTCCCCGTGGCTCACAGCCAGG + Intronic
905191888 1:36242193-36242215 GGTCTCACTGTCCCACAGGCTGG + Intronic
906291003 1:44619116-44619138 CTTCCCAGTGGCCCTCAGGCAGG + Intronic
906769594 1:48472116-48472138 GGCAGCAGTGGCCCCCAGGCCGG + Exonic
907792589 1:57681971-57681993 GGTAGGTGGGGCCCACAGGCTGG - Intronic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
912492607 1:110070437-110070459 GGCTCCAGGGGCCCGCAGGCCGG + Exonic
914345642 1:146796239-146796261 AGGCCCAGTGGTCCACAGGCTGG + Intergenic
915741074 1:158118782-158118804 GGTGCCTGGGACCCACAGGCTGG - Intergenic
920578344 1:207079982-207080004 GTGACCAGTGGCCAAGAGGCAGG - Intronic
920791380 1:209096315-209096337 AGTGCCAGTAGCCCACAGGCTGG + Intergenic
920880645 1:209877231-209877253 GGTACAAGGGGCCCTCAGGGAGG + Intergenic
921196195 1:212760183-212760205 GGTACCAGTGGCCCACAGGCTGG - Intronic
924749418 1:246871805-246871827 GGTAGCAGTGGCCTACTGCCAGG + Intronic
1062788028 10:281506-281528 TGTGCCAGTACCCCACAGGCTGG + Intronic
1063302110 10:4859362-4859384 GGTACCAGAGGCCAAGAGGCAGG + Intergenic
1065840764 10:29699023-29699045 GGAACAACTGGTCCACAGGCTGG + Intronic
1065958571 10:30714784-30714806 GGAACTAGTGGTCAACAGGCAGG - Intergenic
1066381637 10:34906828-34906850 GCTCCCTGTGGCCAACAGGCGGG - Intergenic
1067059978 10:43073271-43073293 GGCACCTGAGGCCCACAGGCAGG + Intergenic
1069606288 10:69740793-69740815 GGCACCACTGGCCCCTAGGCAGG - Intergenic
1069831400 10:71284400-71284422 GGTCTCAGTGGCCTGCAGGCGGG - Intronic
1070119807 10:73565028-73565050 GGTACCAGTGTACTCCAGGCTGG + Intronic
1070164764 10:73889161-73889183 AGGCCCAGTGGCCCACAGGCAGG - Intergenic
1070734177 10:78852162-78852184 GGTACCAGTGGGCACCAGGATGG + Intergenic
1076496893 10:130903509-130903531 GGAACCCCTGGCCCAAAGGCTGG - Intergenic
1077496584 11:2889664-2889686 GGGGCCATTGGCCCACTGGCCGG - Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1084164332 11:67367986-67368008 GGTACAACTGGAACACAGGCAGG - Intronic
1085691517 11:78667982-78668004 TGTCCCAGGGTCCCACAGGCAGG - Intronic
1089291886 11:117442695-117442717 GCTAGCACTGGCCCAGAGGCAGG - Intronic
1089491804 11:118888569-118888591 GGTAACAGTGGCCCTTCGGCTGG + Intronic
1089611223 11:119670512-119670534 GGTCCCAGTGGGCCCCATGCAGG - Intronic
1089639758 11:119839873-119839895 GGCACCAGAGACCCAGAGGCTGG + Intergenic
1102559871 12:113754456-113754478 GGTACCTGGGGCACCCAGGCCGG + Intergenic
1103060023 12:117851156-117851178 GGTCCCAGTGGCCCTAAGGCTGG + Intronic
1103394787 12:120599234-120599256 GAGGGCAGTGGCCCACAGGCAGG - Intergenic
1105508757 13:21033970-21033992 GGGACCAGTCGCACCCAGGCTGG + Intronic
1108647638 13:52446382-52446404 GGTAGCAGTGGAACATAGGCTGG - Intronic
1112042874 13:95565658-95565680 GGTACATGTGCCCCACATGCAGG + Intronic
1113419113 13:110156020-110156042 TAGAGCAGTGGCCCACAGGCAGG - Intronic
1113735088 13:112672709-112672731 TGTCCCAGTGCCCCACAGCCTGG + Intronic
1118793392 14:69116530-69116552 GGTACCTGTGGGCCACTGGCAGG + Intronic
1119443059 14:74641756-74641778 GGTCCCAGCGGCCCACAGTATGG + Intergenic
1120860518 14:89251147-89251169 GGCACCAGTGGCTCACAAGTAGG - Intronic
1121338122 14:93089502-93089524 GATGCCAGATGCCCACAGGCAGG + Intronic
1122271717 14:100571245-100571267 GGGGCTAGTGGCCAACAGGCAGG - Intronic
1125522297 15:40354977-40354999 GGTACCAGTGGGGAAGAGGCAGG - Intronic
1125874627 15:43133465-43133487 GGGACCAGTGGCCGGGAGGCGGG - Intronic
1130239353 15:82171441-82171463 GGCAACAGTGGCAGACAGGCAGG + Intronic
1132844637 16:1994339-1994361 GGCACCAGGGCCCCACAGGAGGG + Intergenic
1135058516 16:19251257-19251279 TCTACCACTGGACCACAGGCTGG + Intronic
1136482014 16:30548002-30548024 GGAACCAGAGGCCCACAGGCCGG + Intronic
1138142788 16:54582967-54582989 GGGGCCAGCGGCCCAGAGGCTGG + Intergenic
1138458539 16:57134633-57134655 GGTATCAGTGGCCTAGAGGAGGG + Intronic
1139988344 16:70919028-70919050 AGGCCCAGTGGTCCACAGGCTGG - Intronic
1140021747 16:71245659-71245681 GGTACCCATGGCCCAAAGGGTGG - Intergenic
1142039774 16:87885610-87885632 GGTACTGGGGCCCCACAGGCTGG - Exonic
1142802019 17:2352252-2352274 TGAACCACTGGCCCCCAGGCAGG + Intronic
1146273163 17:31497743-31497765 GGTGACAGTGGCCCCCAAGCAGG + Intronic
1146636872 17:34513055-34513077 GATACCAGTGTCCCACAGAGTGG + Intergenic
1147689945 17:42308864-42308886 GGTCTCAGTGACCCTCAGGCAGG + Intronic
1148959926 17:51384732-51384754 CGGGCCAGTGGCACACAGGCAGG - Intergenic
1151209334 17:72532660-72532682 GGAACCATGGGCCCGCAGGCAGG + Intergenic
1151743686 17:76000700-76000722 GGCACCAGGGGCCCAGGGGCTGG + Intronic
1151957225 17:77386437-77386459 GGCTCCCGTGGCCCACAGGCAGG + Intronic
1152364808 17:79849503-79849525 CGGCCCAGAGGCCCACAGGCAGG + Intergenic
1154411582 18:14144844-14144866 GGTGCCAGCTGCCCACACGCTGG + Intergenic
1156348298 18:36279283-36279305 GGTACCACTGCACCAGAGGCTGG + Intergenic
1157744527 18:50123265-50123287 GCTACCAGGGGCCAACAGGAGGG + Intronic
1160537558 18:79603190-79603212 GGAACTTCTGGCCCACAGGCTGG - Intergenic
1164507604 19:28872344-28872366 GCTTCCAGGGGCCCTCAGGCAGG + Intergenic
1164746699 19:30621704-30621726 GGAGCCGGTGTCCCACAGGCTGG + Intronic
1164758597 19:30709667-30709689 GGTACCAGTGCACTACAGCCTGG - Intronic
1165960809 19:39532735-39532757 GATAGCAGTGTCCCACAGGTGGG - Exonic
1168353174 19:55687851-55687873 GGGTCCAGGGGCCCCCAGGCTGG - Intronic
925577264 2:5373329-5373351 TGTACCTGTGGCTGACAGGCAGG - Intergenic
932294974 2:70616619-70616641 GGGAGCAGTGGCTCCCAGGCAGG - Intronic
934718079 2:96554687-96554709 GGGCCCAGTGCCCCACAGCCCGG + Intergenic
934973359 2:98781421-98781443 GTTAACTATGGCCCACAGGCTGG + Intergenic
935901756 2:107800160-107800182 GGTGCCAGTGGTCCTCAAGCTGG - Intergenic
936076699 2:109405846-109405868 GGTGCCACTGGCCCACAGGTGGG + Intronic
939331504 2:140768277-140768299 TGTACCAGAAGCCCACATGCTGG + Intronic
940897495 2:159094791-159094813 GACAGCAGTGGCCCCCAGGCTGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948363661 2:237440287-237440309 GGTGGCAGTGGGGCACAGGCTGG - Intergenic
948529540 2:238595577-238595599 GGTACAGGTCGCCCTCAGGCTGG - Intergenic
1171328686 20:24318518-24318540 CGTGCCAGTGTCCCACAGCCTGG + Intergenic
1171461054 20:25298126-25298148 GGGACCTGTGGCCCACTTGCAGG - Intronic
1172434375 20:34918616-34918638 GGTACCAGTGGTGTAAAGGCAGG + Intronic
1173000956 20:39105304-39105326 GGTGCCTGTGTCCCACAGACAGG - Intergenic
1175818868 20:61897776-61897798 GGTTCCAGGGGGCCTCAGGCAGG + Intronic
1175851927 20:62098230-62098252 GGGAACAGTGGACCCCAGGCAGG - Intergenic
1176861472 21:14013580-14013602 GGTGCCAGCTGCCCACACGCTGG - Intergenic
1177911255 21:27035431-27035453 GCTTCAAGTGTCCCACAGGCTGG - Intergenic
1180695087 22:17746833-17746855 GGTTCTAGAGGCCCAAAGGCTGG - Intronic
1181491723 22:23264374-23264396 GGTCTCCTTGGCCCACAGGCAGG - Intronic
1182090496 22:27591353-27591375 GGACCCTGTGGCCCACAGGAGGG - Intergenic
1182334598 22:29575350-29575372 GGAAACTGAGGCCCACAGGCAGG - Intronic
1183476835 22:38040253-38040275 GGTCTCACTGGCCCCCAGGCTGG - Intronic
1183689067 22:39377950-39377972 GGCTCCAGGAGCCCACAGGCTGG + Intronic
1184600840 22:45542463-45542485 GGTGCCAGTGGCCGCCTGGCTGG - Intronic
1184776422 22:46625754-46625776 AGGATCAGTGGCCCACAGGAGGG - Intronic
1185396907 22:50597082-50597104 AGTGCCTGTGGCCCAGAGGCTGG + Intronic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
952884921 3:38006391-38006413 GGAATCAGTAGCCCACAGGGAGG - Intronic
954001188 3:47558410-47558432 GGTCCAAGTGGCCCAAACGCTGG - Intergenic
955217514 3:56996793-56996815 GCAACCTGTGGCCCGCAGGCGGG + Intronic
955508794 3:59658712-59658734 GGTACCAGTAGACCACCAGCTGG - Intergenic
967823441 3:193859465-193859487 GGTCCCAGTGTCTCACTGGCTGG - Intergenic
969475886 4:7422294-7422316 GGGACAAGGGGCCCCCAGGCTGG + Intronic
981988526 4:150887475-150887497 GGGAGCAGTGGCTCACGGGCCGG + Intronic
982179682 4:152738274-152738296 GGTACCACTGCACCATAGGCAGG - Intronic
993468827 5:88281769-88281791 CGTATCAGTGACCCACAGGTTGG - Intergenic
997386945 5:133481017-133481039 GGTTCCAGTGGAACCCAGGCTGG + Intronic
998137253 5:139680599-139680621 GGCAGCAGTGGCCCAAAGGCAGG + Exonic
1003087172 6:3069095-3069117 GGTAACCGCGGCCCAAAGGCAGG - Intronic
1003705752 6:8526844-8526866 GCTACCAGCGTCCCACATGCTGG + Intergenic
1003836014 6:10073481-10073503 CGTTCCAGTGGCCCAGAGACAGG + Intronic
1008057202 6:46957119-46957141 GGAAGCAGTGCACCACAGGCAGG + Intergenic
1014189303 6:118474548-118474570 AGAACCAGTGCCCCACAAGCTGG - Intronic
1014673706 6:124339044-124339066 GGACCCAGTGGCTCACGGGCTGG + Intronic
1017879151 6:158547757-158547779 GGGACCAGTGGCCCGGGGGCAGG - Intronic
1017893687 6:158660464-158660486 TGCACCTGGGGCCCACAGGCGGG + Intronic
1019045870 6:169145563-169145585 GGTATCAGTGACTCCCAGGCTGG + Intergenic
1019493510 7:1325751-1325773 GGTACCAGGGCCCCCCATGCAGG + Intergenic
1020137480 7:5594913-5594935 GGAAAGAGTGGCGCACAGGCCGG - Intronic
1023034053 7:36115572-36115594 GGCATCAGTGGAGCACAGGCTGG + Intergenic
1023055957 7:36290299-36290321 GGTACTATTGACCCACAGCCTGG + Intronic
1028121473 7:87059890-87059912 GGTCCCCGTGGCCCACTGGGAGG + Intergenic
1029474268 7:100773703-100773725 GATCCCTGTGGCCCACAGGTCGG + Exonic
1029933240 7:104395984-104396006 GGTACCAATGGCAAAAAGGCAGG + Intronic
1030735329 7:113041460-113041482 GGAACCAGAGGCTCAAAGGCAGG + Intergenic
1033848281 7:145462604-145462626 GGTGCAAGTGGCCCAAAGTCTGG + Intergenic
1034536148 7:151727287-151727309 GGTCCCAGTCCCCCACAGGCAGG - Intronic
1035690298 8:1555454-1555476 GGAAGCGGTGGCCCAGAGGCAGG - Intronic
1035835945 8:2751874-2751896 TGTAACAGTGCACCACAGGCCGG - Intergenic
1038993893 8:32900436-32900458 GGTAACAAAGGCCCACAGACTGG + Intergenic
1045305580 8:100953329-100953351 GGTGGGAGTGGGCCACAGGCCGG + Intronic
1047563768 8:126017927-126017949 GGTTCCTGTGCACCACAGGCTGG + Intergenic
1049636842 8:143693621-143693643 AGAGCCAGTGGCCCACAGCCAGG - Intronic
1049742997 8:144249937-144249959 GGCACATGTGGCCCAGAGGCTGG - Intronic
1050595020 9:7196287-7196309 GGTACCAGAGTCCAAGAGGCTGG + Intergenic
1052898213 9:33768010-33768032 TGTAACAAAGGCCCACAGGCTGG - Intronic
1057036015 9:91812139-91812161 GCCACAAGTGGCCCACAGGCTGG + Intronic
1057514890 9:95712683-95712705 GGAGCCAGTGGCCCAAAGTCAGG - Intergenic
1058685436 9:107476042-107476064 GGTAACAGTGCCTCAAAGGCAGG + Intergenic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1186101622 X:6163539-6163561 GGAGGCAGTGGACCACAGGCTGG - Intronic
1186173671 X:6903335-6903357 TGTCTCAGTGGCCCACAGACAGG + Intergenic
1186507198 X:10102457-10102479 GGTACCGTTGGCCGACAGGCAGG + Intronic
1187863661 X:23704516-23704538 GATGCCTGTGGCCCCCAGGCGGG - Intronic
1188340150 X:28990139-28990161 TGGACCAGTGGCCCCCAGGTCGG + Intronic
1190562218 X:51696863-51696885 AGAACCAAGGGCCCACAGGCAGG + Intergenic
1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG + Intergenic
1200009210 X:153108674-153108696 GGCACCATAGGCCCACAGGCGGG - Intergenic
1200030390 X:153291248-153291270 GGCACCATAGGCCCACAGGCGGG + Intergenic
1202095367 Y:21243903-21243925 GGTACCAGTGGCCCCCAGCCTGG + Intergenic