ID: 921199544

View in Genome Browser
Species Human (GRCh38)
Location 1:212792001-212792023
Sequence ATACGGGACCAGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921199532_921199544 10 Left 921199532 1:212791968-212791990 CCGCCCCGGACTTTGACCGCGTA 0: 1
1: 0
2: 0
3: 2
4: 8
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
921199533_921199544 7 Left 921199533 1:212791971-212791993 CCCCGGACTTTGACCGCGTATGT 0: 1
1: 0
2: 0
3: 1
4: 12
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
921199534_921199544 6 Left 921199534 1:212791972-212791994 CCCGGACTTTGACCGCGTATGTG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
921199531_921199544 15 Left 921199531 1:212791963-212791985 CCTCTCCGCCCCGGACTTTGACC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
921199535_921199544 5 Left 921199535 1:212791973-212791995 CCGGACTTTGACCGCGTATGTGA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
921199538_921199544 -6 Left 921199538 1:212791984-212792006 CCGCGTATGTGAGGGCGATACGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
921199530_921199544 18 Left 921199530 1:212791960-212791982 CCACCTCTCCGCCCCGGACTTTG 0: 1
1: 0
2: 0
3: 9
4: 165
Right 921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921199544 Original CRISPR ATACGGGACCAGAGGGAGCA GGG Intronic
901023782 1:6268618-6268640 GAACTGGACCAGAAGGAGCATGG - Intronic
903813845 1:26050191-26050213 ATAAGGGACCAGAGACAGGAGGG - Intergenic
905414505 1:37794794-37794816 TGACAGGACCAGAGGGAGCTGGG - Intronic
905604890 1:39288911-39288933 TTACGGGATCAGAGGGAGGTGGG - Intronic
906693796 1:47810761-47810783 TTAGGGGAAGAGAGGGAGCAGGG + Intronic
911083818 1:93959568-93959590 CTACGCAACCAGAGGGAGGAGGG - Intergenic
911650196 1:100379829-100379851 ATATGGCAAGAGAGGGAGCAAGG + Intronic
912670476 1:111619958-111619980 AGACGGCCCCAGAGGGAGCGGGG + Intronic
917711175 1:177687126-177687148 ATCCAGGAACAGAGGGAGCCAGG + Intergenic
918096890 1:181343448-181343470 ATACGGCAAGAGAGGGAGCAAGG - Intergenic
919391949 1:196996773-196996795 TTATGGGACCAGAAAGAGCAAGG - Intronic
921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG + Intronic
1069697560 10:70398191-70398213 AGACAGGACCAGAGGGAACAGGG + Intergenic
1072064552 10:91853266-91853288 CTACAGGACCAGAGGTGGCATGG - Intronic
1072733332 10:97862974-97862996 AGACGGGCCCAGGGGTAGCAGGG + Intronic
1073122896 10:101132916-101132938 AAACGGGAGCAGAGGGAGCCAGG - Intronic
1075917298 10:126179722-126179744 ACACGAGACCAGAAGGACCATGG - Intronic
1078650843 11:13190841-13190863 ATATGGCAAGAGAGGGAGCAAGG + Intergenic
1083912683 11:65719409-65719431 AGCAGGGACCAGAGGGAGCCAGG + Exonic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086774758 11:90816411-90816433 ATATGGCAAGAGAGGGAGCAAGG + Intergenic
1087479397 11:98680530-98680552 TTCAGGGACCAGCGGGAGCAGGG - Intergenic
1092003805 12:5052076-5052098 AGAGGGGTGCAGAGGGAGCAAGG + Intergenic
1093086761 12:14874133-14874155 ATAAGGGAACAGAGCTAGCAGGG + Intronic
1095508585 12:42924885-42924907 ATACTGTACCAGAAGGAGAAAGG + Intergenic
1096789479 12:54035907-54035929 ATACTGGGGAAGAGGGAGCAGGG + Intronic
1097160958 12:57046453-57046475 GTAGGGGCCCAGAGGGAACAGGG + Intronic
1097952292 12:65445298-65445320 ATTCGGGATAAGAGGGAACATGG - Intronic
1098147959 12:67516900-67516922 ATAAGGAAACAGAGGGAACAGGG + Intergenic
1099060822 12:77905972-77905994 AGAAGTGACCAGAGGGAGCAAGG - Intronic
1102924860 12:116819041-116819063 AAACGGGATCAGAGGGATAAAGG - Intronic
1106994376 13:35463826-35463848 ATAAGAGAGCAGAGGGGGCAGGG + Intronic
1107182105 13:37473031-37473053 AGAAGGAACCAGAGGGAGCAGGG - Intergenic
1121343830 14:93120710-93120732 AGACGGGCCCAGAGAGAGAAGGG + Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1126703368 15:51386483-51386505 AGGAGGGACCAGAGGCAGCAGGG + Intronic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1129905921 15:79186966-79186988 ACATGGGACCTGAGGGAGCCAGG + Intergenic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130019106 15:80212213-80212235 ACACGGGACTGGAGGAAGCAGGG - Intergenic
1131674077 15:94653446-94653468 ATACTGCAGCAGAAGGAGCATGG - Intergenic
1131799690 15:96056316-96056338 ATACGGCACTAGAAGGAGAAGGG + Intergenic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1137612604 16:49828966-49828988 ATGAGGGCCCAGCGGGAGCAGGG - Intronic
1139800963 16:69522291-69522313 ATACGGGGCCAGATGGGGGAAGG + Intergenic
1141709007 16:85687335-85687357 ATAACGGAACAGAGGGAGCACGG + Intronic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1142359516 16:89619622-89619644 GGAGGGGAGCAGAGGGAGCAGGG - Intronic
1143684681 17:8504347-8504369 AGATAGGACCAGAGGGAGAAGGG - Intronic
1146448759 17:32954846-32954868 ATACGGGCCAAGACAGAGCAAGG + Intergenic
1148116514 17:45178420-45178442 AGAGGGGAGGAGAGGGAGCAGGG - Intergenic
1148547966 17:48531242-48531264 AGAAGGGACCAGAGGGAGAGGGG + Intergenic
1150135495 17:62692901-62692923 AGAAGGGGCGAGAGGGAGCAGGG - Exonic
1151347983 17:73514939-73514961 ACCCGGGGTCAGAGGGAGCAGGG + Intronic
1154027340 18:10720995-10721017 ATGTGGGACCTGAGGGAGAAAGG - Intronic
1157965729 18:52206164-52206186 ACAGGTGAGCAGAGGGAGCAAGG + Intergenic
1160104894 18:75964855-75964877 ATCCTGAACCAGAGTGAGCAGGG + Intergenic
1163689456 19:18730729-18730751 ATAAGGGCCCAGAGGGGGCAGGG - Intronic
1164840844 19:31391075-31391097 ATATGGGAGGAGAGGGAGAAAGG + Intergenic
1166416621 19:42599915-42599937 TTAGGGGAGCAGGGGGAGCAGGG + Intronic
1166982347 19:46638825-46638847 ACTCGGGACCAGAGGAAGCACGG + Intergenic
1167556235 19:50197666-50197688 AGAGGGGACCAGATGGAGCAGGG + Intronic
1167714430 19:51132171-51132193 ATACGGCAAGAGAGGAAGCACGG - Intronic
1168192673 19:54751208-54751230 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168194761 19:54766036-54766058 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168197011 19:54782481-54782503 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168202807 19:54828920-54828942 ACACGGCAAGAGAGGGAGCAAGG + Intronic
925126877 2:1463686-1463708 AGCCGAGACCAGAAGGAGCAAGG - Intronic
925258980 2:2513109-2513131 GCACGGGAGCGGAGGGAGCATGG - Intergenic
926695094 2:15765610-15765632 ACACGGGCCCAGAGGAAGAAAGG - Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
935261324 2:101358285-101358307 ATAAGGGACCAGATGGGGCTGGG - Intronic
935570346 2:104653745-104653767 ATATGTGGCCAGAAGGAGCAGGG - Intergenic
940626138 2:156177429-156177451 ATAAGGGACCAGAAGTAGCCTGG + Intergenic
941160530 2:162029683-162029705 ATCCAGGAGCAGAGAGAGCAGGG + Intronic
944683433 2:202097299-202097321 ATAAGGGAGGAGGGGGAGCAAGG + Intronic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1173670168 20:44793434-44793456 ATATGGGAGCAGAGGGAGAAAGG - Intronic
1174056416 20:47801471-47801493 ATATGGGAGCAGAGAGAGCAAGG + Intergenic
1174161192 20:48551649-48551671 ATATGGAAGCAGAGAGAGCAAGG - Intergenic
1174332701 20:49832421-49832443 ATAGGGGACCAGAGGGCGCTTGG + Intronic
1174382134 20:50162800-50162822 ATAGGGGACCAGAGGTAGTGTGG + Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1176248120 20:64107027-64107049 ACATGGGGCCAGAGGGAGCCTGG + Exonic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1180831567 22:18909638-18909660 ACACAGCACCAGAGGGAGAAGGG - Intronic
1181814982 22:25430701-25430723 AACAGGGCCCAGAGGGAGCAAGG + Intergenic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1184177791 22:42799444-42799466 AAATGGGCCCAGAGAGAGCAAGG - Intronic
1184504927 22:44894875-44894897 ATCCGGGGCAAGTGGGAGCAGGG - Intronic
1203281651 22_KI270734v1_random:134909-134931 ACACAGCACCAGAGGGAGAAGGG - Intergenic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
957331735 3:78773740-78773762 ATATGAGACTAGAGGGAGGAAGG - Intronic
965667880 3:171115424-171115446 AGAGGGGACAATAGGGAGCATGG + Intronic
970151315 4:13093439-13093461 AAAGGGGAGCAGAGGGACCAGGG - Intergenic
970600166 4:17635823-17635845 ATACTGAATCAGAGGGAGCTGGG + Intronic
975406517 4:73996615-73996637 ATAGGGGACCAGAGAGAGCTTGG - Exonic
995028374 5:107450402-107450424 AGAAGGGAAGAGAGGGAGCATGG - Intronic
997681115 5:135751384-135751406 CTAAGGAACCACAGGGAGCAGGG - Intergenic
997793311 5:136782579-136782601 AGACTGGACCAGAGAGAGCTAGG - Intergenic
998140894 5:139698822-139698844 AGCTGGGAGCAGAGGGAGCAGGG - Intergenic
1001123018 5:168995722-168995744 ACAGGGAAGCAGAGGGAGCAGGG - Intronic
1003042426 6:2700469-2700491 ATCTGTGACCAGAGGGAGCCTGG - Intronic
1007094341 6:39204078-39204100 ATACTGGACGAAAGGCAGCAGGG + Intronic
1012253631 6:97008012-97008034 ATGTGGGACCAGTGGAAGCAGGG + Intronic
1012834842 6:104252043-104252065 CTACTGTAACAGAGGGAGCAAGG + Intergenic
1013783766 6:113756714-113756736 ATACCAGGCCAGAGGTAGCATGG - Intergenic
1015279095 6:131413352-131413374 ATAAAGGACTAGAGGGAGCTGGG + Intergenic
1018462947 6:164016608-164016630 ATAGGGGTCCAGAGAGAGCAAGG - Intergenic
1018701876 6:166433485-166433507 GGACGGGACCAGTGGGAGGAGGG + Intronic
1018739545 6:166717006-166717028 ATCCGGAGCCAGAAGGAGCAGGG + Intronic
1025236578 7:57238690-57238712 ATATGGGAGCAGGGAGAGCAAGG - Intergenic
1028988657 7:97026872-97026894 ATAGGGGACCAGAGGAAGGGAGG - Intergenic
1031416399 7:121501672-121501694 AAACGAGACAAGATGGAGCAGGG + Intergenic
1033467854 7:141612629-141612651 ATAGGGGGCCAGAGGGGACATGG + Intronic
1035729177 8:1842528-1842550 ACATGGGACCACAGGGGGCATGG - Intronic
1038637643 8:29300504-29300526 ATACGGGGGCAGGGGGAGGAGGG - Intergenic
1041369931 8:57148723-57148745 ATAGTAGACCAGAGTGAGCAAGG + Intergenic
1042789911 8:72593651-72593673 ATATAGGACCACAGGGAGTAAGG + Intronic
1043654967 8:82651727-82651749 AGAAGGGAGCAGAAGGAGCAAGG + Intergenic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047214579 8:122865962-122865984 AGGAGGGACCAGAGGGAGCCAGG - Intronic
1048637329 8:136311553-136311575 ATATGGTACAAGAGGAAGCAAGG + Intergenic
1049367035 8:142244818-142244840 GCAGGGGAGCAGAGGGAGCAGGG + Intronic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1050388478 9:5113088-5113110 ATACGGGGGCAGGGGGAGCGAGG - Intronic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1054805881 9:69395630-69395652 ATACGGGTGCAGAGGGAAGAGGG - Intergenic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1059853168 9:118366276-118366298 ATAGGTGACCAGAGGGTCCATGG - Intergenic
1059966457 9:119619297-119619319 ATAAGGGGCCAGGTGGAGCAGGG - Intergenic
1060423836 9:123488316-123488338 TTACAAGACCAGAGGGAGCATGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061377251 9:130233911-130233933 ATGCGGGGACAGAGGCAGCAGGG - Exonic
1061893159 9:133633353-133633375 ACACTGGAGCAGAGGCAGCAGGG + Intergenic
1062735389 9:138134600-138134622 AGAAGGGACCAGAGTGACCATGG + Intergenic
1185920709 X:4088870-4088892 ATTCAGAACCAGAGGCAGCAAGG - Intergenic
1186500961 X:10050219-10050241 AGACTGGATCAGAGGGAGAATGG - Intronic
1187929069 X:24277383-24277405 ATGCGGGGAGAGAGGGAGCATGG - Intergenic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1193077892 X:77374844-77374866 ATACAGGAGTAGAGGAAGCAGGG + Intergenic
1193715940 X:84934773-84934795 ATACGCGACAGGAGGGAGTATGG + Intergenic
1198375262 X:136032478-136032500 ATTCGGGCCCAGAGAGAGAAAGG + Intronic