ID: 921199629

View in Genome Browser
Species Human (GRCh38)
Location 1:212792396-212792418
Sequence GAGATGCGCAGCGCCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921199629_921199633 6 Left 921199629 1:212792396-212792418 CCGAGGCGGGCGCTGCGCATCTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 921199633 1:212792425-212792447 CCAGGAGATCGTGACCAGCCTGG 0: 1
1: 230
2: 13448
3: 168553
4: 277262
921199629_921199634 7 Left 921199629 1:212792396-212792418 CCGAGGCGGGCGCTGCGCATCTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 921199634 1:212792426-212792448 CAGGAGATCGTGACCAGCCTGGG 0: 2
1: 259
2: 10878
3: 56672
4: 67283
921199629_921199635 15 Left 921199629 1:212792396-212792418 CCGAGGCGGGCGCTGCGCATCTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 921199635 1:212792434-212792456 CGTGACCAGCCTGGGCAACATGG 0: 73
1: 5566
2: 69543
3: 182139
4: 212878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921199629 Original CRISPR GAGATGCGCAGCGCCCGCCT CGG (reversed) Intronic
900265708 1:1756032-1756054 GGGGTGGCCAGCGCCCGCCTGGG - Intronic
902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG + Intronic
903384356 1:22916834-22916856 GAGCTGTGCAGCGCCAGGCTGGG + Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
904738158 1:32651050-32651072 GAGGGGCGGAGCGCGCGCCTCGG + Intergenic
905690729 1:39940831-39940853 AAGCTGCGCAACGCCAGCCTTGG - Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916791874 1:168132303-168132325 GAGAGCCACAGCGCCCGGCTTGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
1064208981 10:13347830-13347852 GAGAGGGGCAGCGCCGGGCTTGG - Intronic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1069832872 10:71291704-71291726 CACCTGCGCAGCGCCAGCCTCGG + Exonic
1069909999 10:71753104-71753126 GAGCTGTGCAGGGCCCTCCTGGG - Intronic
1076343517 10:129765667-129765689 GAGATGGTCAGCCCCTGCCTTGG - Intronic
1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG + Exonic
1093641170 12:21528032-21528054 GGGAGCCGCAGCGCCAGCCTGGG - Intronic
1094564923 12:31590802-31590824 GAGCTGCGCGGCGCCCGGCCCGG - Exonic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1119196670 14:72722394-72722416 CCGATGTGCAGCGGCCGCCTGGG + Intronic
1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG + Intergenic
1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123581170 15:21716021-21716043 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123617819 15:22158644-22158666 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1129699282 15:77758344-77758366 CAGATGGGGAGCGCCCGCCTTGG - Intronic
1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG + Intergenic
1132759510 16:1501939-1501961 AAGATGCGGAGCTCACGCCTCGG - Intronic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1133771093 16:8867650-8867672 AAGAGGCGCAGAGCCCGGCTGGG - Intronic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG + Intergenic
1143417964 17:6763821-6763843 GAGATGCGCTGCCCCAGCCACGG + Intronic
1151309875 17:73286406-73286428 GAGATGATCAGCGCCCCGCTGGG - Exonic
1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG + Intergenic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1160106908 18:75986947-75986969 GAGATATGCAGGGCCCGCCCTGG - Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
1167915291 19:52735175-52735197 GAGACGCGCAGATCCCGCCCCGG - Intergenic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG + Intronic
935653139 2:105399046-105399068 GAGCTGCGCAGCGCTCCACTCGG - Intronic
948682580 2:239645975-239645997 GAGATGCCCAGCGCCCTGCAAGG - Intergenic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1175399529 20:58692728-58692750 GAGACGTGCAGGGCCCGCCCGGG - Exonic
1178485871 21:33020004-33020026 GGGCTGCGCAGCGCGCGCCCGGG - Intergenic
1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG + Intronic
1180875210 22:19171919-19171941 GAGAGGCGCTGTGCCCGCCAGGG - Intergenic
1183287035 22:36973288-36973310 GAGATGCCCAGCCCCTCCCTTGG - Intergenic
1185322657 22:50209084-50209106 GAGATGCTGAGTGCCCACCTGGG + Intronic
954442946 3:50531612-50531634 GGGATGGGCAGCACCAGCCTTGG - Intergenic
954493424 3:50930339-50930361 CAGATCCACAGCCCCCGCCTTGG + Intronic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
964630146 3:158801710-158801732 GAGAAGGGCAGCGCGCGTCTTGG + Intronic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
986333076 5:6732166-6732188 GAGATACAAAGCGCCTGCCTGGG + Intronic
992089358 5:73303649-73303671 GAGATGCGCGGCGTCCGCGCGGG + Intergenic
997228942 5:132228846-132228868 GAGATGCCCAGCCTCCGCCCAGG + Intronic
997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG + Exonic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1005926720 6:30451275-30451297 GAGTTGGGCAGCGCCGGCCGGGG + Intergenic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG + Intergenic
1013538904 6:111088096-111088118 GTGAGGCGCGGCGCCCGCCGAGG + Intronic
1021446469 7:20739057-20739079 CAGATGCGCAGCCCCCGATTTGG - Exonic
1022121698 7:27314634-27314656 GTGAGGAGCTGCGCCCGCCTGGG - Intergenic
1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG + Exonic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1038281748 8:26171435-26171457 GAGATGCAGTGCGCCAGCCTGGG + Intergenic
1039842727 8:41305339-41305361 GAGAAGTGCAGAGCCCTCCTTGG - Intronic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1203435221 Un_GL000195v1:131370-131392 GAGATGCTCAAGGCCCACCTCGG - Intergenic
1192560512 X:72124984-72125006 GAGATGGGCAGGGCCCACCTGGG - Intergenic
1199252734 X:145682705-145682727 GAGATGCACAGCCCAGGCCTTGG - Intergenic