ID: 921199631

View in Genome Browser
Species Human (GRCh38)
Location 1:212792418-212792440
Sequence GGTCACGATCTCCTGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3935
Summary {0: 1, 1: 0, 2: 5, 3: 140, 4: 3789}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921199631_921199641 30 Left 921199631 1:212792418-212792440 CCTGTGTCCAGGAGATCGTGACC 0: 1
1: 0
2: 5
3: 140
4: 3789
Right 921199641 1:212792471-212792493 TACAAAAAAAAAAAAAAAGCCGG 0: 28
1: 233
2: 4316
3: 21430
4: 92303
921199631_921199635 -7 Left 921199631 1:212792418-212792440 CCTGTGTCCAGGAGATCGTGACC 0: 1
1: 0
2: 5
3: 140
4: 3789
Right 921199635 1:212792434-212792456 CGTGACCAGCCTGGGCAACATGG 0: 73
1: 5566
2: 69543
3: 182139
4: 212878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921199631 Original CRISPR GGTCACGATCTCCTGGACAC AGG (reversed) Intronic
Too many off-targets to display for this crispr