ID: 921199633

View in Genome Browser
Species Human (GRCh38)
Location 1:212792425-212792447
Sequence CCAGGAGATCGTGACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459494
Summary {0: 1, 1: 230, 2: 13448, 3: 168553, 4: 277262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921199624_921199633 23 Left 921199624 1:212792379-212792401 CCCAGCACTTTGGGAGGCCGAGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
Right 921199633 1:212792425-212792447 CCAGGAGATCGTGACCAGCCTGG 0: 1
1: 230
2: 13448
3: 168553
4: 277262
921199626_921199633 22 Left 921199626 1:212792380-212792402 CCAGCACTTTGGGAGGCCGAGGC 0: 81513
1: 207817
2: 222817
3: 151393
4: 177060
Right 921199633 1:212792425-212792447 CCAGGAGATCGTGACCAGCCTGG 0: 1
1: 230
2: 13448
3: 168553
4: 277262
921199629_921199633 6 Left 921199629 1:212792396-212792418 CCGAGGCGGGCGCTGCGCATCTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 921199633 1:212792425-212792447 CCAGGAGATCGTGACCAGCCTGG 0: 1
1: 230
2: 13448
3: 168553
4: 277262
921199622_921199633 30 Left 921199622 1:212792372-212792394 CCGTAATCCCAGCACTTTGGGAG 0: 4251
1: 4726
2: 3577
3: 3425
4: 5834
Right 921199633 1:212792425-212792447 CCAGGAGATCGTGACCAGCCTGG 0: 1
1: 230
2: 13448
3: 168553
4: 277262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921199633 Original CRISPR CCAGGAGATCGTGACCAGCC TGG Intronic
Too many off-targets to display for this crispr