ID: 921199635

View in Genome Browser
Species Human (GRCh38)
Location 1:212792434-212792456
Sequence CGTGACCAGCCTGGGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470199
Summary {0: 73, 1: 5566, 2: 69543, 3: 182139, 4: 212878}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921199631_921199635 -7 Left 921199631 1:212792418-212792440 CCTGTGTCCAGGAGATCGTGACC 0: 1
1: 0
2: 5
3: 140
4: 3789
Right 921199635 1:212792434-212792456 CGTGACCAGCCTGGGCAACATGG 0: 73
1: 5566
2: 69543
3: 182139
4: 212878
921199629_921199635 15 Left 921199629 1:212792396-212792418 CCGAGGCGGGCGCTGCGCATCTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 921199635 1:212792434-212792456 CGTGACCAGCCTGGGCAACATGG 0: 73
1: 5566
2: 69543
3: 182139
4: 212878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921199635 Original CRISPR CGTGACCAGCCTGGGCAACA TGG Intronic
Too many off-targets to display for this crispr