ID: 921200097

View in Genome Browser
Species Human (GRCh38)
Location 1:212796394-212796416
Sequence CTGATTGTATTGATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921200097 Original CRISPR CTGATTGTATTGATGAAGCA TGG Intronic
902234906 1:15051003-15051025 CAGAGTGTGTTTATGAAGCACGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904885777 1:33737239-33737261 CTGATTGCACTGAGGAAGAATGG + Intronic
905392781 1:37648588-37648610 CTGATTGTAGTGGTCAAGCCTGG + Intergenic
906314938 1:44780582-44780604 CTCACTGTGATGATGAAGCATGG - Intergenic
907410031 1:54277410-54277432 CTGATTGGATGGCGGAAGCAGGG - Intronic
909107006 1:71424155-71424177 TTGATTGAATTGATTAATCATGG - Intronic
909960649 1:81836907-81836929 CTGATGGTTTTGATGAAGCTGGG + Exonic
911603214 1:99869212-99869234 GTGATTGTGTTGATGAATCTCGG + Intronic
913276009 1:117138328-117138350 CTAACTGTGTTGATGAAGCATGG + Intergenic
917032992 1:170715664-170715686 CTTATTTAATTGATGAAGCAAGG + Intronic
917371463 1:174298294-174298316 CTGCTTGCACTCATGAAGCAGGG + Intronic
918182414 1:182095991-182096013 CTGGTTGAATTAATGAAGGAAGG + Intergenic
918972697 1:191440233-191440255 TTGATGGTATTGTTGGAGCAAGG + Intergenic
921200097 1:212796394-212796416 CTGATTGTATTGATGAAGCATGG + Intronic
1062865529 10:849292-849314 CTGATTCTAAGGCTGAAGCAAGG + Intronic
1064576525 10:16751560-16751582 CTGAATGAATTAATGAAGCAAGG - Intronic
1066299449 10:34083990-34084012 CTGATTGGAGTGATGAAGGATGG + Intergenic
1066424647 10:35295525-35295547 CTGTTTGTAATGATGAGGCTGGG - Intronic
1068730644 10:60354080-60354102 CTGATTGTATTGGAGAAGGTGGG - Intronic
1069264581 10:66442623-66442645 CTTATTGTGTTGAGGAAGTAGGG - Intronic
1069336428 10:67356758-67356780 CTGATTGTAATGATGGACCATGG - Intronic
1069541864 10:69300687-69300709 CTCACTGTGATGATGAAGCATGG - Intronic
1070461321 10:76673433-76673455 AAGATTGTATAGATGCAGCATGG + Intergenic
1071230554 10:83580535-83580557 CTGATTGAACTGATTAGGCAGGG + Intergenic
1071613677 10:87055265-87055287 GTGACTGTAATGATGGAGCACGG + Intronic
1072622295 10:97088124-97088146 CTGATTTTATTGATCAGGGAGGG + Intronic
1074381852 10:112987587-112987609 CTAAGTGTGATGATGAAGCATGG + Intronic
1075349814 10:121713718-121713740 CTCACTGTGATGATGAAGCATGG + Intergenic
1078424319 11:11236991-11237013 CAGCTTTTATTTATGAAGCAAGG + Intergenic
1079143473 11:17830260-17830282 CTGATTGAATGCATGAAGTAGGG + Intronic
1080005687 11:27403996-27404018 TTTATTGTATTGAATAAGCATGG + Intronic
1080914256 11:36639335-36639357 CTGATTGTATTGACTGAGAATGG + Intronic
1081194594 11:40146155-40146177 ATGAGTGTAGTGATGAAGGATGG + Intronic
1081460220 11:43265967-43265989 CTGATTGTATTAGGGAAGGAAGG - Intergenic
1081635756 11:44720644-44720666 CTGATTGCATTGATTATGCCAGG + Intergenic
1082190015 11:49231858-49231880 CTCATTGTATTTAATAAGCAAGG - Intergenic
1084999083 11:73012720-73012742 CTGACTGAATGAATGAAGCAGGG - Intronic
1086676514 11:89614684-89614706 CTCATTGTATTTAATAAGCAAGG + Intergenic
1086978380 11:93164017-93164039 CTGATTTTAGGGCTGAAGCAAGG - Intronic
1093304092 12:17490761-17490783 ATGATAGTGGTGATGAAGCAGGG + Intergenic
1093690305 12:22102219-22102241 CTGATTGAAGTGATCAGGCAGGG + Intronic
1097774250 12:63627874-63627896 CTGGTTGAATTAATGAAGAAAGG + Intronic
1097914695 12:65008301-65008323 CTGATTGTTTTGATGTCACAGGG - Intergenic
1100331480 12:93586833-93586855 CTTGTTGTAGTCATGAAGCAAGG + Intergenic
1105282968 13:18980088-18980110 CTAATTGAGTTGAAGAAGCATGG - Intergenic
1106589997 13:31090701-31090723 GTGTTTGTATTGGTGCAGCAAGG - Intergenic
1107589707 13:41890168-41890190 CTGATTGAACTGATGCTGCATGG - Intronic
1108561109 13:51645236-51645258 CTGTTTGTATTGCTGTTGCAGGG + Intronic
1108894156 13:55302196-55302218 TGGGTTGTATAGATGAAGCAGGG - Intergenic
1109590982 13:64481353-64481375 GTGTGTGTATTGATGAAGAAAGG - Intergenic
1112299886 13:98220199-98220221 CTGATTGTACTGATAATGGAAGG + Intronic
1112631715 13:101168718-101168740 CTGATGGTATTGATGCCACAGGG - Intronic
1115074081 14:29363998-29364020 ATTATTTTGTTGATGAAGCAAGG - Intergenic
1115349480 14:32378351-32378373 CTGGTGGTATTCATTAAGCATGG + Intronic
1116028072 14:39537876-39537898 CTGATTGTGGTGATCAGGCAGGG - Intergenic
1116626654 14:47273277-47273299 CTGATATTATTAATGAAGCCAGG + Intronic
1121116378 14:91345968-91345990 CCTATTGTATTGAGGAAGAAAGG + Intronic
1123787655 15:23688902-23688924 AGGATTATATTTATGAAGCATGG - Intergenic
1124470280 15:29978025-29978047 CTCATTGCATTGCAGAAGCACGG + Intergenic
1128303589 15:66582878-66582900 CTGGTTATATTGATGTAGGATGG + Intronic
1128637304 15:69311360-69311382 ATGATTGGACTGATGAAGCCTGG + Intronic
1129077236 15:73007635-73007657 CTGTTGGTATTGATGTGGCATGG - Intergenic
1129144838 15:73637279-73637301 ATGATTATAATGATGAATCATGG - Intergenic
1130160943 15:81399379-81399401 CTGATTGCCTTGATGTAGCCTGG + Intergenic
1132220175 15:100099461-100099483 ATGATTGTATTTATGAGGCTTGG + Intronic
1132346088 15:101109836-101109858 CTTATTGTCTTCATGATGCAAGG + Intergenic
1135002521 16:18788980-18789002 CTCACTGTGATGATGAAGCATGG - Exonic
1135461779 16:22650361-22650383 ATGATTGTATGGAGGAAGAAAGG + Intergenic
1136218815 16:28814227-28814249 CTAACTGTGATGATGAAGCATGG - Intergenic
1138870211 16:60874209-60874231 TTGATTGTATTACAGAAGCAGGG - Intergenic
1140558751 16:75952557-75952579 CTGCCTGTATTTATGAAGGAAGG - Intergenic
1149474870 17:56952123-56952145 CTAACTATAATGATGAAGCATGG + Intronic
1150333015 17:64309540-64309562 CTCATTTCATTGATGAAGAAAGG + Intergenic
1150996403 17:70322851-70322873 ATGATTGTGATGAAGAAGCAGGG + Intergenic
1151392613 17:73797779-73797801 CTGGCTGTGTTGCTGAAGCAAGG - Intergenic
1153123514 18:1761744-1761766 ATGATTGTCTTTATGAAGAAGGG - Intergenic
1153349469 18:4062631-4062653 CTGATTATTTGCATGAAGCACGG - Intronic
1154319392 18:13333968-13333990 TTGAATCTATTGATGAAGCTGGG + Intronic
1156031436 18:32717758-32717780 GTGAGTGTATTGATGAAGGAAGG - Intronic
1158067371 18:53426789-53426811 TTGAGTGGATGGATGAAGCACGG + Intronic
1162010345 19:7809649-7809671 CTTAGTGTACTGATTAAGCATGG + Intergenic
1163146331 19:15381245-15381267 CTGATTGTAGTGGTGAAAAATGG + Intronic
1163172078 19:15538483-15538505 ATGAATGAATTAATGAAGCAAGG - Intronic
1163952371 19:20601645-20601667 CTGATTGGATTTATGTAGCCTGG - Intronic
1163964029 19:20726756-20726778 CTGATTGGATTTATGTAGCCTGG + Intronic
1167847368 19:52175583-52175605 CTGATGTTATTGATTTAGCAAGG + Intergenic
1168667574 19:58216286-58216308 CTAATTGTGATGATGAAGCATGG + Intergenic
926415686 2:12647441-12647463 CAAACTGTAATGATGAAGCATGG + Intergenic
926839320 2:17061142-17061164 CTGATTGTATTCTTGTACCATGG - Intergenic
929570373 2:43019072-43019094 CTGATTGTGTTGAAGAACAATGG - Intergenic
931610845 2:64098576-64098598 TTGATTGTGTTGAAGAAGGATGG - Intronic
931630172 2:64291342-64291364 CTGACTGCAGTGATGAAGAAAGG + Intergenic
932510882 2:72288841-72288863 CTAACTGTGTTGCTGAAGCATGG + Intronic
935408076 2:102730369-102730391 CTGATTGTATATGTGCAGCATGG - Intronic
935473230 2:103484959-103484981 AGGATTGTACTGATGAAGCCAGG - Intergenic
936358902 2:111777952-111777974 CTGATTCAATAGATGAGGCATGG + Intronic
936663419 2:114567480-114567502 CTGATTTTGAAGATGAAGCAAGG + Intronic
936745813 2:115575103-115575125 CTGATTGTGTTCTTAAAGCAGGG - Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
938309781 2:130281697-130281719 TTGTTTGTAGGGATGAAGCAGGG - Intergenic
939131301 2:138238582-138238604 CTGATTATATTAATAAAGAATGG - Intergenic
940087043 2:149871850-149871872 CTGATTGGATTCATCTAGCATGG + Intergenic
942119954 2:172766686-172766708 CTGTTGGTGTTGATGAAGAAAGG - Intronic
943897300 2:193381428-193381450 CAGATTGTTGTGATGAAACATGG - Intergenic
944247958 2:197551885-197551907 CTGATTGTAATGAGGCAGTAAGG + Exonic
947932480 2:233975245-233975267 GTAAATGCATTGATGAAGCACGG + Intronic
1169435994 20:5590763-5590785 CTGATTGTCTTGTTAAAGGAAGG + Intronic
1170976136 20:21166463-21166485 CTCATTGTGATGATGAAGCATGG - Intronic
1172591316 20:36119997-36120019 CTACTTGGAGTGATGAAGCAAGG - Intronic
1177124517 21:17179730-17179752 TTGATTGTATTGTTGACCCAAGG - Intergenic
1177563505 21:22787264-22787286 CTCAATGAATTGATGAAACAAGG + Intergenic
1182579421 22:31296166-31296188 CTGATTGCCTTGAGGAAGGAAGG - Intergenic
1183825708 22:40385252-40385274 GTGAGTTGATTGATGAAGCATGG + Intronic
1185027038 22:48420549-48420571 CTGATTGTCTTGTTGAATCATGG - Intergenic
950369165 3:12513535-12513557 CCCATTGTATAGATGAGGCATGG + Intronic
950704308 3:14770454-14770476 TTGTTTGTATAGATCAAGCAAGG - Intronic
951243795 3:20316896-20316918 CTGATTGAATTGAGGAATCAGGG + Intergenic
951406698 3:22308972-22308994 CTTATTTTATTGCAGAAGCAAGG - Intronic
951675252 3:25232757-25232779 ATGATTGTATAGATAAAGTACGG - Intronic
952277979 3:31895926-31895948 CTGAGTGCATTGCTGAAACAGGG - Intronic
956441364 3:69283513-69283535 CTGTTTGTCTTGAGAAAGCAAGG - Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956778202 3:72583970-72583992 TTTATTGTATTGATGAACCATGG - Intergenic
958532890 3:95357116-95357138 GTGATTGATTTGATCAAGCAAGG - Intergenic
958814282 3:98899785-98899807 CTGATTGTAGTGAAGATTCAAGG + Intronic
961634870 3:128327045-128327067 CTGTGTGTAGTGATGAGGCAAGG - Intronic
962076048 3:132082497-132082519 ATGATTGTAAGGATGAAACAAGG + Intronic
962126823 3:132628485-132628507 TTGATTGGATTGTTGAAGGACGG - Intronic
962567877 3:136681825-136681847 CTGATTGTTTTTATCATGCAAGG - Intronic
963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG + Exonic
964526810 3:157623343-157623365 ATAATTGAATTGATGAAGGAAGG + Intronic
964851753 3:161103480-161103502 CTGAGTGTTTTAATTAAGCATGG - Exonic
967427933 3:189348977-189348999 CAGCTTGTATTGATGCAGCTAGG + Intergenic
971292231 4:25354324-25354346 TTCAGTGTATTGATGAAGAAAGG + Intronic
976745812 4:88402017-88402039 GTGATTATAGTGATGAACCATGG + Intronic
977311167 4:95389150-95389172 CTGAAAGTATTTATAAAGCAGGG + Intronic
977682238 4:99809484-99809506 CTGTTTGTGCTGGTGAAGCAAGG - Intergenic
978279938 4:106999273-106999295 CAGATTTTATTTATGAAGTAGGG - Intronic
979153686 4:117354735-117354757 CTGATTGTATACAAGGAGCAGGG + Intergenic
979244645 4:118487571-118487593 CTGAATGTAATGGTGAAGAATGG + Intergenic
982103380 4:151990441-151990463 CTGTTGGTTTTGATGAATCATGG - Intergenic
983478829 4:168248142-168248164 CTTATTGTATTGCTGAAATATGG - Intronic
983762627 4:171430951-171430973 TTGATTGTACTGATGGAACATGG - Intergenic
984184602 4:176528492-176528514 CTGATTGTATTTGTGCAGCTTGG - Intergenic
984892243 4:184504390-184504412 CTGATTGTATTCAAGAAGAAAGG + Intergenic
985189336 4:187354875-187354897 CTGACTGTTTGGATGAAGGATGG - Intergenic
986501796 5:8408799-8408821 CTCATTCTATTCATGAAGAATGG - Intergenic
987670960 5:21007961-21007983 CAGATGGTACTGATGAAGAAAGG + Intergenic
988211958 5:28215382-28215404 CTAATTGTTTTGATGTAGCTAGG + Intergenic
989266387 5:39479519-39479541 GTGATTGTGTTGAGGAAGAAAGG - Intergenic
989558025 5:42819617-42819639 ATGATTGATTTGATCAAGCAAGG - Intronic
994793736 5:104266035-104266057 ATGATTGTGTGGATGAACCAGGG - Intergenic
994938505 5:106288397-106288419 CTGATTGTATTGCAGAGGCATGG - Intergenic
994952746 5:106485577-106485599 TTGATTGTATGGGTGAACCAAGG - Intergenic
998841838 5:146262472-146262494 TTGATTGAATAGATGAAGGAAGG + Intronic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1001794001 5:174486612-174486634 AGGATTGAATAGATGAAGCATGG + Intergenic
1002592493 5:180300365-180300387 CTGATTGTATTAATGAAACCAGG + Intergenic
1002994226 6:2268013-2268035 TTGCTTGTATGGATGAAGCATGG + Intergenic
1005631402 6:27711588-27711610 CTGAATGAATTTATGAAGTAAGG - Intergenic
1006651567 6:35555984-35556006 CTCACTGTGATGATGAAGCATGG + Intergenic
1007657663 6:43461558-43461580 CTAATTATAATGATGAGGCATGG - Intergenic
1009321669 6:62298150-62298172 CTGATTGTTTTGAAGGAGAAAGG + Intergenic
1009829977 6:68917842-68917864 TTGATTGCATTTTTGAAGCATGG - Intronic
1010562899 6:77372412-77372434 CTTATTTTATTGATGAATCATGG - Intergenic
1012946058 6:105466952-105466974 GTGATTTTCATGATGAAGCATGG + Intergenic
1013937167 6:115611051-115611073 CAGATTGTAAGGAAGAAGCAAGG + Intergenic
1014431959 6:121381580-121381602 CTAACTGTGATGATGAAGCATGG + Intergenic
1015371934 6:132463914-132463936 GTGTTTGTGTTGAGGAAGCAGGG - Intronic
1016099233 6:140076868-140076890 CTGAATTGATTGATGAGGCAAGG - Intergenic
1016748272 6:147604842-147604864 CTTATTGGATTGCTGGAGCATGG + Intronic
1019932055 7:4230295-4230317 ATGAATGAATTGATGAAGGAAGG + Intronic
1020748867 7:12113326-12113348 TTGATTTTGTTGATGAAGTACGG - Intergenic
1021026910 7:15679762-15679784 CTAATTCTATTGATAAAACAAGG + Intronic
1021764105 7:23929543-23929565 CTCTGTGTATTGGTGAAGCAAGG + Intergenic
1022231667 7:28420066-28420088 CTGATTGGATGGAGGCAGCATGG + Intronic
1022611625 7:31880746-31880768 CTGTGTATATTGATGAAACAAGG - Exonic
1024179065 7:46870613-46870635 CTGATTGCATTGTAGAAGAAAGG + Intergenic
1027686745 7:81287849-81287871 CTGACTCTATTGATGGAGTATGG - Intergenic
1028727434 7:94103542-94103564 TTGATTATATTGATGAACCAGGG + Intergenic
1030154852 7:106444227-106444249 CTGAGGGTATTGCTGAAACAAGG + Intergenic
1030427608 7:109398884-109398906 CTGACTCTATTGATGGTGCAGGG + Intergenic
1030747495 7:113184961-113184983 CTGATTGTTTGGAAGAGGCAGGG + Intergenic
1031382523 7:121105101-121105123 CTGATTGTATTGATGTGAGAGGG - Intronic
1033558945 7:142512662-142512684 ATGATTGTATTTATCAAGTAAGG - Intergenic
1034455943 7:151170223-151170245 CTGATTGTATTAGCCAAGCACGG + Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1037129049 8:15385574-15385596 GTGACTCTATTAATGAAGCAGGG + Intergenic
1037346723 8:17909025-17909047 CTGATTAGACTGAAGAAGCATGG + Intronic
1038729922 8:30117642-30117664 CTCACTGTGATGATGAAGCATGG - Intronic
1040683552 8:49842680-49842702 CTGATTGCTTTGGTGAGGCAGGG - Intergenic
1041336262 8:56787904-56787926 TTGATTGTAGTGATGTATCATGG + Intergenic
1043714928 8:83470141-83470163 CTGATTTTATCTATCAAGCAAGG - Intergenic
1044793186 8:95868972-95868994 ACGATTGAGTTGATGAAGCATGG - Intergenic
1045284638 8:100779876-100779898 CTGCTTTTTTTGATGCAGCATGG + Intergenic
1046926183 8:119791727-119791749 CTGATTGTATTGATGGATTTGGG - Intronic
1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG + Intergenic
1049018236 8:139936632-139936654 CTGAGTGTGGTGATAAAGCAGGG + Intronic
1049302813 8:141880532-141880554 CTGCTTGTGAGGATGAAGCAGGG - Intergenic
1050833728 9:10049315-10049337 CTGAAAGTATTGAAGATGCAGGG - Intronic
1052741466 9:32396657-32396679 CCCATTCTATTGATAAAGCAGGG - Intronic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1055436316 9:76295586-76295608 CTGCTTTTATTACTGAAGCATGG + Intronic
1059312783 9:113400153-113400175 CTGATTGTATCACTGAAACAAGG + Intronic
1062071470 9:134557372-134557394 CTGAGTGCAGTGTTGAAGCACGG - Intergenic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1188691236 X:33131579-33131601 CTGATTGATTTGAAGGAGCATGG - Intronic
1189519211 X:41748322-41748344 CTAACTGTGATGATGAAGCATGG + Intronic
1192790042 X:74372566-74372588 CATATTGTATTGATGTAGCTAGG + Intergenic
1195619632 X:106939950-106939972 CTCATTCTAATGATGAAGCCTGG + Intronic
1195758987 X:108225970-108225992 CAAATGGTATTTATGAAGCAGGG + Intronic
1195856616 X:109338833-109338855 CTGATTGAAGTGGTCAAGCAAGG + Intergenic
1197790129 X:130246258-130246280 CTGTTTATATTCATGAAGGAGGG - Intronic
1201446236 Y:14058706-14058728 CTGTTAGTATTGTTCAAGCAGGG + Intergenic