ID: 921207029

View in Genome Browser
Species Human (GRCh38)
Location 1:212858121-212858143
Sequence CGGGCGAGAACTTCGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207029_921207043 26 Left 921207029 1:212858121-212858143 CCGCCTCCCGAAGTTCTCGCCCG 0: 1
1: 0
2: 1
3: 3
4: 55
Right 921207043 1:212858170-212858192 GGACAAAGGCGCACGCTGATTGG 0: 1
1: 0
2: 0
3: 1
4: 54
921207029_921207044 30 Left 921207029 1:212858121-212858143 CCGCCTCCCGAAGTTCTCGCCCG 0: 1
1: 0
2: 1
3: 3
4: 55
Right 921207044 1:212858174-212858196 AAAGGCGCACGCTGATTGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 47
921207029_921207041 12 Left 921207029 1:212858121-212858143 CCGCCTCCCGAAGTTCTCGCCCG 0: 1
1: 0
2: 1
3: 3
4: 55
Right 921207041 1:212858156-212858178 CTGGCTCTCGCGCCGGACAAAGG 0: 1
1: 0
2: 0
3: 0
4: 33
921207029_921207034 -7 Left 921207029 1:212858121-212858143 CCGCCTCCCGAAGTTCTCGCCCG 0: 1
1: 0
2: 1
3: 3
4: 55
Right 921207034 1:212858137-212858159 TCGCCCGGTAGCTCCCCGACTGG 0: 1
1: 0
2: 0
3: 0
4: 29
921207029_921207037 5 Left 921207029 1:212858121-212858143 CCGCCTCCCGAAGTTCTCGCCCG 0: 1
1: 0
2: 1
3: 3
4: 55
Right 921207037 1:212858149-212858171 TCCCCGACTGGCTCTCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207029 Original CRISPR CGGGCGAGAACTTCGGGAGG CGG (reversed) Intergenic
901506550 1:9689324-9689346 CGGGCGAGAACAGCGGGGGTCGG + Intronic
902410204 1:16207784-16207806 AGGGCGAGAACTGAGGGTGGGGG + Intronic
903223913 1:21884492-21884514 CGGGTGAGCGCTGCGGGAGGTGG - Intronic
906323869 1:44832385-44832407 CGGGTCAGAACTTGGGAAGGGGG + Intronic
909488691 1:76202484-76202506 GGGGAGAGAACTTGGGGTGGAGG - Intronic
915954555 1:160211198-160211220 CGGGTGAGAAAGTCGGGAGCAGG + Intronic
918736605 1:188071833-188071855 CGGGCCTGAACTTGGGAAGGTGG + Intergenic
921207029 1:212858121-212858143 CGGGCGAGAACTTCGGGAGGCGG - Intergenic
922721413 1:227901975-227901997 CGGTGGAGAAGCTCGGGAGGAGG + Intergenic
923961172 1:239085162-239085184 CTGGCCAGAACTCGGGGAGGGGG - Intergenic
924160945 1:241231043-241231065 GGGTGGAGAACTTAGGGAGGAGG - Intronic
1076915955 10:133423299-133423321 CGGGCGTGGACTTCGGGCGCTGG - Exonic
1096737237 12:53665280-53665302 CGCGGGAGAACTATGGGAGGTGG + Exonic
1102752152 12:115304548-115304570 CAGGGGAGAAGTTTGGGAGGGGG - Intergenic
1106170893 13:27286968-27286990 AGGGCGAGAGATTTGGGAGGTGG + Intergenic
1110274013 13:73622388-73622410 GGGGCTAGAAACTCGGGAGGGGG - Intergenic
1111522749 13:89427467-89427489 TGGGCGAGAACTCCGGAAAGGGG - Intergenic
1117898609 14:60511114-60511136 CGGGCGGGCACTACGGGCGGAGG + Exonic
1118837003 14:69484719-69484741 CGGGCGGGAACTCCGCGGGGAGG - Intronic
1122628644 14:103097453-103097475 CAGGCGAGAGCCTTGGGAGGTGG + Intergenic
1129351567 15:74958561-74958583 AGGGCGAGAACAGCGGGAGGAGG - Intronic
1130952760 15:88605349-88605371 GGGGCGAGAAGCGCGGGAGGAGG - Intergenic
1138431762 16:56973366-56973388 TGGGCGAGAAGGTGGGGAGGGGG - Exonic
1141531444 16:84649069-84649091 CGGGAGGGAGCTTGGGGAGGAGG + Intronic
1142764810 17:2059015-2059037 CGGGGGAGAACCCCGGGACGGGG + Exonic
1145041817 17:19582723-19582745 GTGGCAAGAACTTCGGGGGGCGG + Intergenic
1145042593 17:19587987-19588009 GTGGCAAGAACTTCGGGGGGCGG - Intergenic
1147593232 17:41699257-41699279 CAGGCGAGAACTGCTGCAGGTGG - Intergenic
1150806938 17:68326723-68326745 GGGGAGAGAGCTTGGGGAGGAGG + Intronic
1150807267 17:68329270-68329292 CGGGAGAGAGCTTGGGGAGGAGG + Intronic
1155919624 18:31590336-31590358 CAGGAGAGGACTCCGGGAGGTGG - Intergenic
1161454007 19:4361312-4361334 TGGGCGAGAAGTTGGGGAGCGGG + Exonic
925132671 2:1504513-1504535 CGGGCGGGGACATCCGGAGGTGG - Intronic
934661330 2:96145149-96145171 CAGGCGAGAACGGCGGCAGGAGG + Exonic
937149885 2:119679131-119679153 GGGGCGGGGACTTCGGGAGGCGG - Intergenic
949025379 2:241765295-241765317 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025397 2:241765345-241765367 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025415 2:241765395-241765417 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025433 2:241765445-241765467 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025650 2:241766045-241766067 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025666 2:241766095-241766117 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025775 2:241766395-241766417 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025793 2:241766445-241766467 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025901 2:241766745-241766767 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025919 2:241766795-241766817 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025937 2:241766845-241766867 GGGGGGAGAACTTGGGGAGATGG + Intronic
1175367601 20:58466757-58466779 CAGCCGAGAACTAAGGGAGGGGG + Intronic
1176242049 20:64079782-64079804 TGGGCGGGAGCTTCGGGAGCCGG - Intronic
956224446 3:66940518-66940540 CAGAGGAGAACTTTGGGAGGAGG - Intergenic
957159397 3:76589384-76589406 ATGGCGGGAACCTCGGGAGGCGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
992629937 5:78670114-78670136 ATGGCGTGAACCTCGGGAGGCGG - Intronic
1000264332 5:159620111-159620133 CAGGTGAGAACCTCAGGAGGAGG + Intergenic
1004278691 6:14260241-14260263 AGGGAGAGAACTAAGGGAGGTGG + Intergenic
1014137610 6:117907443-117907465 CGGGCCAGGACTTGGGGACGCGG + Intergenic
1014547819 6:122753477-122753499 TGGGCGAGAACTTGGGGAGGAGG - Intergenic
1014569922 6:122996433-122996455 CGGGAGAGAAGGTGGGGAGGAGG - Exonic
1041368596 8:57135140-57135162 GGGATGAGAACTTGGGGAGGGGG - Intergenic
1189337233 X:40177108-40177130 GGGGCGAGTTCTCCGGGAGGGGG + Intronic
1192044061 X:67653496-67653518 AGGAAGAGAACTTCAGGAGGAGG + Intronic