ID: 921207157

View in Genome Browser
Species Human (GRCh38)
Location 1:212858576-212858598
Sequence ACCGGGAAGGTGCCCGCTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207157_921207179 29 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207157_921207172 15 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207172 1:212858614-212858636 GGACAGCCTCGCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 107
921207157_921207173 16 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207173 1:212858615-212858637 GACAGCCTCGCTGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 158
921207157_921207175 24 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207157_921207177 28 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207157_921207176 25 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207157_921207163 -7 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207163 1:212858592-212858614 TCCCGGTGAATGGGGCCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 120
921207157_921207165 -6 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207165 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207157 Original CRISPR ACCGGGAAGGTGCCCGCTTT GGG (reversed) Exonic
919980180 1:202637999-202638021 ACCGGGGAATTGCCCGCTGTTGG - Intronic
921207157 1:212858576-212858598 ACCGGGAAGGTGCCCGCTTTGGG - Exonic
1065175068 10:23067967-23067989 ACAGGGAAGGAGCCCGGTTTGGG - Intergenic
1078055984 11:8009312-8009334 CCAGGGAAGGAGCCAGCTTTGGG - Intergenic
1102867067 12:116382882-116382904 AGCGGGAAAGTGCAGGCTTTGGG + Intergenic
1102979552 12:117230593-117230615 ACTGGGAAGGAGCCCCCATTGGG + Intronic
1105510430 13:21047420-21047442 CCAGGGAAGGTGCCCGCTGGTGG + Intronic
1107099549 13:36574898-36574920 ACCAGGAAGGTACATGCTTTGGG + Intergenic
1116651263 14:47595736-47595758 ACTGGGAAAGTGCCCACTCTAGG + Intronic
1131920843 15:97327027-97327049 ACCAGGAAGGAGCCAGCTATAGG - Intergenic
1133149056 16:3812851-3812873 ACTGGGAAGGTCCCCGCATAGGG + Intronic
1141412873 16:83847421-83847443 ACCGGGAAGGTGTCACCCTTGGG - Intergenic
1141431042 16:83970300-83970322 ACCAGGTAGGTGCCGGCTCTGGG - Intronic
1144017812 17:11213257-11213279 ATCGGGCAAGTGCCCACTTTGGG + Intergenic
1144107194 17:11997124-11997146 AGCGGGGAGGAGCCCGTTTTCGG + Intronic
1147160168 17:38564854-38564876 ACAGGGAATGTGCCTGATTTAGG + Intronic
1150272784 17:63877231-63877253 ACTGGGAAGTTGCCCACTGTTGG + Intronic
1150278439 17:63914530-63914552 ACTGGGAAGTTGCCCACTGTTGG + Intronic
1161108474 19:2455948-2455970 ACCGGGAAGGGTCCCGGCTTGGG - Intronic
1161963562 19:7535596-7535618 ACCGGGTAGGTGCCGGCGTGGGG + Intronic
929761796 2:44813379-44813401 GCTGGGAAGGTGCCTGCTTGTGG + Intergenic
930024698 2:47023018-47023040 ACCAGAAAGGTGCCTGGTTTGGG + Intronic
942642192 2:178072171-178072193 ACCGGGAAGGGGCTGGCTGTGGG + Exonic
1175186991 20:57185370-57185392 ACCAGGAAGGTGGCAGATTTAGG + Intronic
969613911 4:8241506-8241528 GCCAGGAAGGTGCCCCCATTAGG + Intronic
984748740 4:183251249-183251271 CCCGGCAATGTGCCAGCTTTCGG + Intronic
988657631 5:33229527-33229549 CCCGGGAAGCTGACCTCTTTTGG - Intergenic
996633563 5:125665200-125665222 ACAGGGAAGGTGTCCCCATTGGG + Intergenic
997521581 5:134527036-134527058 ACCAGGAAGATGCCGGCTTGTGG + Intronic
1018940539 6:168306815-168306837 ACAGGGCACGTGCCAGCTTTGGG - Intronic
1029537316 7:101164115-101164137 TTCGGGAAGGGGCCCGCTGTCGG + Exonic
1048678173 8:136808471-136808493 AGCAGGAAGGAGCCAGCTTTAGG + Intergenic
1049470488 8:142773159-142773181 ACCGGGAGGGAGGCGGCTTTGGG - Intronic
1057699456 9:97352614-97352636 ACATGGAAGGTGCCCACTCTTGG - Intronic
1062058728 9:134483130-134483152 ACAGGAAAGGTGCCCGCTGTCGG + Intergenic
1192529376 X:71872226-71872248 AGCGGGAAGGTGGCCGTTTCTGG + Intergenic