ID: 921207158

View in Genome Browser
Species Human (GRCh38)
Location 1:212858577-212858599
Sequence CACCGGGAAGGTGCCCGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207158_921207172 14 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207172 1:212858614-212858636 GGACAGCCTCGCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 107
921207158_921207173 15 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207173 1:212858615-212858637 GACAGCCTCGCTGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 158
921207158_921207179 28 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207158_921207177 27 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207158_921207165 -7 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207165 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 110
921207158_921207175 23 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207158_921207176 24 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207158_921207163 -8 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207163 1:212858592-212858614 TCCCGGTGAATGGGGCCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207158 Original CRISPR CACCGGGAAGGTGCCCGCTT TGG (reversed) Exonic
900397245 1:2458141-2458163 CACAGGGAAGGTGGCCGGCTGGG + Intronic
901214606 1:7548675-7548697 CCCATGGAAGGTGCCCCCTTAGG + Intronic
901214730 1:7549033-7549055 CCCATGGAAGGTGCCCCCTTAGG + Intronic
901685068 1:10939173-10939195 CACCTGGAAAGAGCCCGCATTGG - Intergenic
904673727 1:32184628-32184650 CGCAGGGAAGGTGCCCGCGGAGG - Intronic
906960873 1:50418923-50418945 CAGCGGGTAGGCGCCCGCGTCGG + Exonic
908710039 1:67005027-67005049 CACCAGGAAGGATCCCTCTTTGG + Intronic
921207158 1:212858577-212858599 CACCGGGAAGGTGCCCGCTTTGG - Exonic
1065175069 10:23067968-23067990 GACAGGGAAGGAGCCCGGTTTGG - Intergenic
1069421818 10:68253302-68253324 CACCGGGTAGCTGCCGGCCTTGG + Intergenic
1075352069 10:121733116-121733138 GACCGCGAAGGTGCCTGCCTAGG + Intergenic
1077024736 11:434045-434067 CAGCGGGAAGCTGTCCCCTTCGG + Exonic
1078055986 11:8009313-8009335 CCCAGGGAAGGAGCCAGCTTTGG - Intergenic
1081492991 11:43581519-43581541 CTTCGGGAAGGTGCGGGCTTCGG - Intronic
1102979551 12:117230592-117230614 CACTGGGAAGGAGCCCCCATTGG + Intronic
1104914157 12:132256197-132256219 CACAGGGAAGGGGCCTGCCTGGG - Intronic
1107099548 13:36574897-36574919 CACCAGGAAGGTACATGCTTTGG + Intergenic
1108689214 13:52847090-52847112 CACCAGGTAGCTGCCCGCGTAGG + Exonic
1108727841 13:53201327-53201349 CACCAGGCAGCTGCCCGCGTAGG - Intergenic
1118817487 14:69323519-69323541 CACTGGGAGGGTGCACACTTAGG + Intronic
1122619592 14:103047668-103047690 CTCAGGGAATCTGCCCGCTTCGG - Intronic
1131592736 15:93767365-93767387 CACAGGGAACATGCCAGCTTGGG + Intergenic
1132285600 15:100660055-100660077 CACTTGGAAGGAGCCCGCGTGGG + Intergenic
1133149055 16:3812850-3812872 GACTGGGAAGGTCCCCGCATAGG + Intronic
1136049335 16:27639285-27639307 CACAGGGAAGGTGGCAGCTCGGG - Intronic
1141431043 16:83970301-83970323 CACCAGGTAGGTGCCGGCTCTGG - Intronic
1148856183 17:50580396-50580418 CACTGGGGAGGTGCCCCCTGGGG - Intronic
1152183523 17:78840311-78840333 CACGAGGAAGGTGCCCGCCCCGG + Intronic
1158531154 18:58262860-58262882 GACCAGGAAAGTGCCCGTTTAGG - Intronic
1159901855 18:74054017-74054039 CATCTGGCAGGTGCCCCCTTGGG + Intergenic
1161963561 19:7535595-7535617 GACCGGGTAGGTGCCGGCGTGGG + Intronic
1162452918 19:10765558-10765580 CACTGGGAAGGTGTCAGCCTGGG - Intronic
926791649 2:16577909-16577931 CATTGGGAAGGTGCCCTCTAGGG + Intronic
933991220 2:87635119-87635141 CACTGTGACGGTGCCCCCTTCGG + Intergenic
936350394 2:111707904-111707926 CACCGGGCAGATGCCAGCCTGGG + Intergenic
942642191 2:178072170-178072192 CACCGGGAAGGGGCTGGCTGTGG + Exonic
944608016 2:201370384-201370406 CACCTGGCAGGTGCCCCTTTTGG + Intergenic
1172661890 20:36573966-36573988 CCCCGGGAGGAAGCCCGCTTGGG + Intronic
1175611250 20:60352972-60352994 GACCAGGAAGCTGCCTGCTTGGG + Intergenic
1180002870 21:45002960-45002982 CACCTGCTAGGTGCCTGCTTGGG + Intergenic
951864650 3:27294606-27294628 CAACGGGAAGGTGCAGGCATGGG - Intronic
952075709 3:29694921-29694943 CACCAGGAATGTGTCTGCTTAGG - Intronic
955856526 3:63278681-63278703 CACCCGGAAGGTGCCCGCAGAGG - Exonic
966694579 3:182777262-182777284 CACAGGGTAGGTGCCAGCTGTGG + Intergenic
967950716 3:194838193-194838215 CACTGGGAAGGTGCTCTCCTAGG - Intergenic
1001035312 5:168292525-168292547 CTCCGGGCAGGTGCCGGCTGGGG - Intronic
1006603497 6:35241161-35241183 AACCGGGGAGGTTGCCGCTTTGG + Exonic
1012535454 6:100291513-100291535 CACTGGGAAGCTGCCTGTTTGGG - Intergenic
1018940540 6:168306816-168306838 CACAGGGCACGTGCCAGCTTTGG - Intronic
1024522346 7:50316521-50316543 CTCCAGGAAGGTGCTCGCTGTGG + Intronic
1034993814 7:155565782-155565804 CACTGGGCAGGGGCCCTCTTGGG + Intergenic
1036456641 8:8915121-8915143 CTCCGGTAATCTGCCCGCTTCGG - Intergenic
1036635517 8:10547623-10547645 GAAGGGGAAGGTGCCAGCTTGGG - Intronic
1040576747 8:48659048-48659070 CACCGCTGAGGTGCCCCCTTGGG + Intergenic
1041583886 8:59494506-59494528 CACCTGGAAGGTGCCCCTCTGGG - Intergenic
1049436092 8:142586907-142586929 CACCGGGAAGGACCCCACTGGGG + Intergenic
1049704659 8:144035693-144035715 CTCTGGGAAGGTGGCCGCTGTGG - Intronic
1052236698 9:26219350-26219372 CACTAAGAAGGTGCCCTCTTGGG - Intergenic
1060191820 9:121598659-121598681 CCCCGGGCAAGTGCCCGCGTAGG - Intronic
1186151100 X:6675669-6675691 CAGAGGGAAGGTACCCCCTTGGG - Intergenic
1196545149 X:116954641-116954663 CACATGGAAGCTGCCCACTTGGG - Intergenic