ID: 921207162

View in Genome Browser
Species Human (GRCh38)
Location 1:212858589-212858611
Sequence GGGGGCCCCATTCACCGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207162_921207173 3 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207173 1:212858615-212858637 GACAGCCTCGCTGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 158
921207162_921207172 2 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207172 1:212858614-212858636 GGACAGCCTCGCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 107
921207162_921207177 15 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207162_921207175 11 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207162_921207176 12 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207162_921207179 16 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207162 Original CRISPR GGGGGCCCCATTCACCGGGA AGG (reversed) Exonic
900012910 1:131838-131860 GTGGGCCACCTTCACCTGGAAGG - Intergenic
900042975 1:487825-487847 GTGGGCCACCTTCACCTGGAAGG - Intergenic
900064412 1:722822-722844 GTGGGCCACCTTCACCTGGAAGG - Intergenic
900242802 1:1624973-1624995 GGGGGCCTCTTTCCCCAGGAGGG + Exonic
901399230 1:9004737-9004759 GGGGCCCTCACTCACCTGGATGG + Exonic
915457955 1:156053323-156053345 GGGGACACCTTGCACCGGGAAGG - Intronic
917981495 1:180272265-180272287 GGAGGCCCCAGTCAGCAGGAGGG - Intronic
918497377 1:185156391-185156413 GGGGAGGCCCTTCACCGGGATGG - Intronic
920201612 1:204263058-204263080 GGGGGCACCAGTCACAAGGAAGG + Intronic
921207162 1:212858589-212858611 GGGGGCCCCATTCACCGGGAAGG - Exonic
921678665 1:218006211-218006233 GGGGGCACCATTCACTGTGATGG - Intergenic
922099311 1:222468836-222468858 GTGGGCCACCTTCACCTGGAAGG - Intergenic
922261350 1:223948331-223948353 GTGGGCCACCTTCACCTGGAAGG - Intergenic
922595076 1:226807246-226807268 GGAGGTTCCATTCACTGGGATGG + Intergenic
922735726 1:227977412-227977434 GTGGGCCACCTTCACCTGGAAGG + Intergenic
924342508 1:243050508-243050530 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1066733962 10:38455044-38455066 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1069823049 10:71239366-71239388 GGAGGCCCCAGGCACAGGGAGGG + Intronic
1076243542 10:128928345-128928367 CGGGGGCCCCATCACCGGGAGGG + Intergenic
1076779151 10:132714445-132714467 CGGGGCCCCATTCACGGCGTTGG + Intronic
1076969247 11:124042-124064 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1081734843 11:45395416-45395438 GGGGGCCCCAGTCACCCTGGTGG + Intergenic
1084873550 11:72114118-72114140 GGGGGCCAAAGTCACTGGGAAGG + Intergenic
1094133032 12:27095204-27095226 GGGGGCTGCATTCACCTGGAGGG - Intergenic
1094182805 12:27610014-27610036 GGGGGCTGCATTCACCTGGAGGG - Intronic
1094283879 12:28770585-28770607 GGGGGAACCACTCACCAGGAAGG + Intergenic
1094317620 12:29149876-29149898 GGCGGTCCCAGGCACCGGGAGGG - Intronic
1096670112 12:53193527-53193549 GGGAGCCCCAGTCAGGGGGAGGG + Exonic
1102912881 12:116731878-116731900 GGGGGCCTCATTCAGCCTGAGGG - Intronic
1103623877 12:122204474-122204496 GGCGGTGCCATTCACCGAGAAGG - Intronic
1104492864 12:129209595-129209617 GGAGACCACTTTCACCGGGACGG + Exonic
1107749128 13:43545532-43545554 GTGGGCCCCAGTCACCGTGAGGG + Intronic
1113459695 13:110473116-110473138 GGGGGCCTCTGTCTCCGGGAAGG - Exonic
1123034546 14:105466591-105466613 GAGGGCCACACTCACCGGGCGGG - Intronic
1125361160 15:38866327-38866349 GGGGGTGCCATTCACTGGGATGG - Intergenic
1128224853 15:65994495-65994517 GGGGGCCTTTTTCACCGGGTGGG + Intronic
1133050084 16:3112627-3112649 GGGGGCCCCCTCCCCCGGGAAGG - Exonic
1133545972 16:6807410-6807432 GGTGGTGCCATTCACCTGGATGG + Intronic
1134020269 16:10916479-10916501 GGGGGCCCGATTCAGCAGGAAGG - Intronic
1136367040 16:29813677-29813699 GGGGGCCCCATTGGCTGGGGGGG - Exonic
1137961268 16:52884407-52884429 GGGGGCCCTGTCCACTGGGACGG + Intergenic
1138754784 16:59470049-59470071 AGGGGCACCATTCACAGTGATGG - Intergenic
1142150512 16:88510612-88510634 GGCGGCCCCATTCCCCTGGCTGG + Intronic
1142451426 16:90175080-90175102 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1142804585 17:2364762-2364784 GGGAGCCCCATTAACAAGGATGG - Intronic
1144575993 17:16429781-16429803 AGGGGCCCCTTCCACGGGGAGGG + Intronic
1145208863 17:20998499-20998521 GGGTACCCCATTCACAGTGACGG + Intergenic
1149517548 17:57292096-57292118 AGGGGACGCATTCACCGAGAAGG + Intronic
1151208028 17:72522709-72522731 GGGGGTCCCATTCTCACGGATGG + Intergenic
1157711210 18:49850916-49850938 GGGCTCCCCATTCACTGGGCTGG - Intronic
1160646052 19:193968-193990 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1161016373 19:1985701-1985723 TGGGGCCCCATTCTGCGGCAGGG + Exonic
1162584241 19:11549462-11549484 GGGGCCCCCACTCACCTGGCTGG - Exonic
1162759607 19:12880957-12880979 CGGGGCCCCCTTCACCTGGCTGG + Exonic
1163395588 19:17058747-17058769 GTGGCCTCCATTCACGGGGAGGG - Intronic
1165098116 19:33421328-33421350 TTGGGCCCCATTCACAGGTATGG - Intronic
932099527 2:68885094-68885116 GGCAGCCCCATTCCCTGGGACGG - Intergenic
938260670 2:129893023-129893045 GGGTGCTGCATTCACCGAGAAGG + Intergenic
938477071 2:131626443-131626465 GGGGGCCTCAGTCAGCAGGATGG - Intergenic
948445424 2:238029186-238029208 GGGGGGCCCATGCTCAGGGAAGG - Intronic
1173367356 20:42399028-42399050 GGTGGCCCCAGACACTGGGAGGG + Intronic
1173849925 20:46211344-46211366 GGGGACCCCATACACAGGGTAGG - Intronic
1176115954 20:63432003-63432025 GAAGGCCCCATCCACAGGGAAGG + Intronic
1176161329 20:63650446-63650468 GTGGGCACCATCCACCTGGACGG - Intronic
1176161348 20:63650502-63650524 GTGGGCACCATCCACCTGGACGG - Intronic
1176161445 20:63650772-63650794 GTGGGCACCATCCACCTGGACGG - Intronic
1176279454 20:64292248-64292270 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1179657127 21:42852427-42852449 GGGGTCCCCAGGCACCAGGAGGG - Intronic
1181067300 22:20312959-20312981 GAGGGCCCCATTCACCCAGCGGG - Intergenic
1182295557 22:29309724-29309746 GGGGGCCCCATGCCCCTGGGTGG - Intronic
1184297197 22:43532310-43532332 GGTGGCCCCTTTCACTGGGGAGG + Intronic
1185041510 22:48506776-48506798 GGGGTCCCCAACCACCAGGATGG + Intronic
950114746 3:10443510-10443532 GGCTGCCGCATTGACCGGGATGG + Intronic
950683334 3:14600553-14600575 AGGGGCCCCAGCCAGCGGGAGGG - Intergenic
951117829 3:18885942-18885964 GGAGGCCCCACTCTCAGGGAAGG - Intergenic
954314897 3:49795722-49795744 GGGGGCCAGATTCTCAGGGATGG + Exonic
968371629 3:198225558-198225580 GTGGGCCACCTTCACCTGGAAGG + Intergenic
968745898 4:2359938-2359960 GGGACCCCCATCCACCTGGAAGG + Intronic
970826632 4:20284154-20284176 AGGGGCCCCATTCTCCAGGCAGG - Intronic
972034757 4:34506668-34506690 GGGGGCGGCATTCATCGGGGAGG + Intergenic
979260314 4:118638033-118638055 GTGGGCCACCTTCACCTGGAAGG + Intergenic
990397227 5:55394685-55394707 GGGGTCCCCAAGCCCCGGGATGG - Intronic
999273051 5:150309241-150309263 GGGGACCCCATTCACAGGCTTGG - Intronic
1002730868 5:181331104-181331126 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1002753665 6:143000-143022 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1021813810 7:24428380-24428402 GGGGGCCACATTCCCAGGGAGGG + Intergenic
1022250820 7:28606493-28606515 GAGGGCCCTATTCCCAGGGATGG - Intronic
1023402032 7:39797633-39797655 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1024529800 7:50382568-50382590 CGGGGCCTCATTCACCCAGAAGG + Exonic
1024647590 7:51383026-51383048 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1025051424 7:55737521-55737543 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1025176778 7:56806070-56806092 GTGGGCCACCTTCACCTGGAAGG - Intergenic
1025695016 7:63770316-63770338 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1026630380 7:72032760-72032782 GGGTGCTCCATTCCCAGGGAGGG + Intronic
1026898353 7:74023358-74023380 GGGGGCAGCACTCACAGGGATGG + Intergenic
1032052543 7:128658026-128658048 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1034470315 7:151251418-151251440 GTGGGCCCCATTCACAAGGCAGG + Intronic
1035605439 8:927079-927101 GAGGGCCCCAGTGGCCGGGATGG + Intergenic
1041713489 8:60913594-60913616 GGAGGCCCCTGTCACCGGGATGG + Intergenic
1042963820 8:74329981-74330003 GGGGACCCACTTCACCGTGAAGG + Intronic
1046672361 8:117070275-117070297 TGGGGCTGCATTCAGCGGGAGGG + Intronic
1049280407 8:141741282-141741304 GGGGACCCCAGCCACAGGGAGGG - Intergenic
1057511176 9:95680644-95680666 GGGGGCCGCACTCATCGGGGAGG - Intergenic
1062116804 9:134814012-134814034 GGGGGCCGCCTTCTCCCGGAAGG - Exonic
1062266114 9:135687294-135687316 GGGGGCACCTTCCACTGGGAGGG - Intergenic
1062755275 9:138283611-138283633 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1203579186 Un_KI270745v1:27783-27805 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1187337423 X:18393326-18393348 GGATACCCCATTCACCGTGATGG - Intergenic
1187883302 X:23865670-23865692 AAGGGGCCCATTCACCTGGAGGG + Intronic
1189114533 X:38329196-38329218 GGGGGCACCATTTACTGAGATGG + Intronic
1196588765 X:117460917-117460939 GGAGGGCCCATTCTCCTGGAGGG + Intergenic
1201723056 Y:17123561-17123583 GGATGCCCCATTCTCCGTGATGG - Intergenic
1202381796 Y:24280403-24280425 GTGGGCCACCTTCACCTGGAAGG + Intergenic
1202488989 Y:25389723-25389745 GTGGGCCACCTTCACCTGGAAGG - Intergenic