ID: 921207164

View in Genome Browser
Species Human (GRCh38)
Location 1:212858593-212858615
Sequence CCCGGGGGGCCCCATTCACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207164_921207177 11 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207164_921207179 12 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207164_921207173 -1 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207173 1:212858615-212858637 GACAGCCTCGCTGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 158
921207164_921207175 7 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207164_921207172 -2 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207172 1:212858614-212858636 GGACAGCCTCGCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 107
921207164_921207176 8 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207164_921207181 28 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207181 1:212858644-212858666 GGGCGGGCCTCAGACTCCACTGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207164 Original CRISPR CCCGGGGGGCCCCATTCACC GGG (reversed) Exonic
900164900 1:1240680-1240702 CCCCGCCGCCCCCATTCACCCGG + Intergenic
900191650 1:1354663-1354685 CCAGGGAGGCCTCCTTCACCTGG + Exonic
900649103 1:3722382-3722404 CCTGGGGGGGCCCATGCTCCTGG + Intronic
900762297 1:4481559-4481581 CCCAGCTGGCCCCATCCACCAGG - Intergenic
903213637 1:21831651-21831673 CCTGGGAGGTCCCATTGACCGGG + Exonic
905043086 1:34976496-34976518 CCCTGGGCGCCCCCTTCACCAGG + Intergenic
905734355 1:40315633-40315655 CCCGGGGGGCCCCGCTCTCCCGG + Exonic
905886721 1:41495743-41495765 CCTGGGGGGCCCCCTTCTGCCGG + Intergenic
907550628 1:55301813-55301835 CCCAGTGGGTCCCATACACCTGG + Intergenic
908241834 1:62194933-62194955 CACGCCGGGCCCCATGCACCCGG - Intronic
909423032 1:75487790-75487812 CCCAGGGGTCCCCAGTCCCCAGG + Intronic
910254692 1:85236143-85236165 ACTGGGAGCCCCCATTCACCTGG - Intergenic
910295002 1:85635691-85635713 CCATGTGGGCCCCCTTCACCAGG + Intergenic
912726546 1:112063799-112063821 CCCAGGGGTCCCCATCCCCCTGG - Intergenic
917974490 1:180230173-180230195 CCCGGGAGGCCGCGGTCACCCGG - Intergenic
918114737 1:181485951-181485973 CCCGGGGCTCCCCAGTTACCCGG + Intronic
921207164 1:212858593-212858615 CCCGGGGGGCCCCATTCACCGGG - Exonic
1063464065 10:6231901-6231923 CCCGGTGGGCACCCATCACCTGG + Intronic
1064330643 10:14391016-14391038 CCCGAGGGCCAACATTCACCTGG + Intronic
1067583529 10:47461662-47461684 CCCGGACGGCCCCTTTCCCCGGG - Intronic
1067633532 10:47987010-47987032 CCCGGACGGCCCCTTTCCCCGGG - Intergenic
1069960999 10:72079393-72079415 CCTGGGGGCCCCCGTTCTCCAGG + Intronic
1070598543 10:77849592-77849614 CCTGGGGGACCCCAATGACCAGG + Intronic
1070890858 10:79941460-79941482 CCCGGGGGTCCCCTGGCACCTGG + Exonic
1071734820 10:88286585-88286607 TTCAGGGGGCTCCATTCACCTGG + Intronic
1073682536 10:105719670-105719692 CCAGGGGTACCCCATTCTCCGGG - Intergenic
1075838257 10:125474753-125474775 CCTCTGGGGCCCCACTCACCTGG - Intergenic
1076433328 10:130422752-130422774 TTCGGGGGGCCTCATTCTCCTGG + Intergenic
1077469178 11:2748807-2748829 CCCCAGGGGCACCATTCACCTGG - Intronic
1083332580 11:61905832-61905854 CCCGGGAGGCCCCATTTATCAGG + Intronic
1083721866 11:64607464-64607486 CCCGGCGGGCCCCGCTCCCCAGG + Exonic
1084428336 11:69097665-69097687 CCCAGGGAGCCCGATTCAGCTGG - Intergenic
1085171314 11:74452213-74452235 CCCCAGAGGCCCCCTTCACCAGG + Intergenic
1085208079 11:74749086-74749108 TCCGGGGGGCTCCAGGCACCCGG - Exonic
1086399853 11:86451608-86451630 CCTGGGGGGGACCATCCACCTGG + Intronic
1086437864 11:86800050-86800072 CCCAGGGCTCCCCATACACCAGG + Intronic
1089519134 11:119052130-119052152 CCCGAGTGGCCCCACCCACCAGG + Exonic
1089658878 11:119972664-119972686 CCCAGGGAGCCCCTTCCACCAGG - Intergenic
1091453281 12:586882-586904 CACGGGGGACGCCATTCACTGGG + Intronic
1091973109 12:4804702-4804724 CCCCAGGGGCCCCATCCTCCTGG - Intronic
1092124243 12:6064529-6064551 TCTAGGGGGCCCCATTCACATGG - Intronic
1101903996 12:108812036-108812058 CCCCAGAGGCCCCATTCACACGG - Intronic
1101961748 12:109256082-109256104 CCTGGGGGCCCCCAGCCACCTGG + Intronic
1113458465 13:110465471-110465493 CCTGGGGGGCCCATTTCTCCTGG - Exonic
1113459670 13:110473024-110473046 CCAGGGAGGCCCCTTTCCCCAGG - Exonic
1113968760 13:114172102-114172124 CCCCGAGGGCCCCACTGACCCGG + Intergenic
1121451427 14:94010728-94010750 CACGTGGGGCCCCAAACACCAGG + Intergenic
1121602834 14:95218730-95218752 CCCACTGGGCCCCATTTACCAGG - Intronic
1122934634 14:104950251-104950273 CCCGGAGGGCCCCCTTCCCGAGG - Exonic
1127219986 15:56869757-56869779 TCCAGGGGGCGCCATCCACCTGG - Intronic
1127900248 15:63335867-63335889 CCCAGGGGGCTGCATTCACGAGG - Intronic
1128074589 15:64818287-64818309 CCCCTCGGGCACCATTCACCAGG + Exonic
1130713666 15:86310566-86310588 CCCCAGGGGCCCCCTGCACCAGG - Intronic
1132414852 15:101612772-101612794 GCCGGAGGGCCTCACTCACCAGG - Intergenic
1134243535 16:12523246-12523268 CCCAGGAGGCCCCATACATCAGG - Intronic
1135047876 16:19169004-19169026 CCCGGGGCGCGCCAGCCACCCGG + Intronic
1136997945 16:35203575-35203597 CCCAGGGGTCCCCATGCAACAGG - Intergenic
1138022194 16:53494820-53494842 CCTGAGGGCCACCATTCACCTGG + Intronic
1139590071 16:67928503-67928525 CCCCAGGTGCCCCATTCCCCAGG - Exonic
1142270845 16:89088621-89088643 TCCAGGGGGCCCCATTAAGCCGG + Intronic
1142974581 17:3636033-3636055 CCCCGGGGGTCCAACTCACCTGG + Exonic
1143108138 17:4539603-4539625 ACCCGGGAGCTCCATTCACCTGG + Exonic
1143370245 17:6434990-6435012 CCGGAGGGGCCCCACTCACTCGG + Exonic
1143502686 17:7348243-7348265 CCAGGGGTCCCCCATTCCCCTGG - Intronic
1146722066 17:35130591-35130613 ACATAGGGGCCCCATTCACCTGG + Exonic
1148021795 17:44558208-44558230 CCCGGGGTGCCCCCGGCACCCGG - Exonic
1148610787 17:48963222-48963244 CCTGGGTGGCACCTTTCACCAGG - Intronic
1149577693 17:57725847-57725869 TCAGGGGGGACCCAGTCACCAGG - Intergenic
1150830278 17:68512545-68512567 CCCGGCCGACCCCACTCACCTGG - Exonic
1152092415 17:78254365-78254387 CCCGGAGCGCCCCATGTACCGGG + Intergenic
1152255065 17:79234184-79234206 CCCAGGGGGTCCCCTTCACATGG - Intronic
1152336472 17:79702163-79702185 CCCAGGGGGCCCCAGTGTCCAGG - Intergenic
1152743431 17:82028553-82028575 CCCTGGGGGCCCCCGTCCCCCGG - Intronic
1156492602 18:37505236-37505258 CCTGGCTGGCCCCAGTCACCAGG - Intronic
1157711212 18:49850920-49850942 CCCTGGGCTCCCCATTCACTGGG - Intronic
1160923024 19:1529435-1529457 CCTGGAAGGCCCCATCCACCTGG + Exonic
1161171413 19:2814133-2814155 CCCTGGCGGCCCCACTCCCCTGG + Exonic
1161474253 19:4475396-4475418 CCGGGGTGGCCTCACTCACCTGG + Intronic
1162584243 19:11549466-11549488 CCCGGGGGCCCCCACTCACCTGG - Exonic
1162978877 19:14225611-14225633 CCAGGAGGGCCCCATTCTCATGG - Intergenic
1163313263 19:16526397-16526419 CCCAGGCTGCCACATTCACCAGG + Intronic
1163363000 19:16859810-16859832 CCCTGGGGGCCCCTTTTCCCAGG - Intronic
1164540778 19:29120115-29120137 CCAGGTGGCCCCCATGCACCAGG + Intergenic
1166105764 19:40597354-40597376 CCCGGGGGTCCCCAGCCGCCCGG + Exonic
1166853535 19:45771370-45771392 CACGGGGGTCCCCAGTCCCCGGG - Exonic
1167638133 19:50667014-50667036 CCTGGGGACCCCCATCCACCAGG - Exonic
1168427785 19:56252885-56252907 GCCAGGGGGCCCCATTCACGTGG + Intronic
925292099 2:2754960-2754982 CAAGGGGGCCCCCATCCACCAGG + Intergenic
928169079 2:28991887-28991909 CCCGGGTCGCCCCATTCCCTGGG + Intronic
928207674 2:29298160-29298182 CCCTGGGGGCCCCAATGCCCTGG - Intronic
930755281 2:54967023-54967045 CCAGGGGGACCTCATGCACCTGG - Exonic
933364037 2:81325368-81325390 CCTAGGGTGCCCCACTCACCAGG + Intergenic
935058363 2:99587366-99587388 TCCTGGGAGCCCCACTCACCTGG + Intronic
935692826 2:105745457-105745479 CCCGGGGGTCTCCAGTCCCCGGG - Intronic
936038041 2:109128508-109128530 CCCGGGGTGCCCCCTTCAACTGG + Intergenic
936521680 2:113215640-113215662 GCCGAGGGGCCACTTTCACCTGG - Intergenic
942444006 2:176066564-176066586 CCCGTGGGGCCACCCTCACCTGG + Intergenic
946241621 2:218359509-218359531 CCCTGGGGGCCTGTTTCACCTGG - Intronic
1170011140 20:11725415-11725437 CCCAGGGGACCCCCTTCCCCAGG + Intergenic
1172281663 20:33712133-33712155 CCCGGCTGTCCCCAGTCACCTGG - Intronic
1173820141 20:46014206-46014228 TCCGGAGGGCCCCGGTCACCTGG - Exonic
1174404729 20:50295919-50295941 CCCCAGGGGCCGCATTCACATGG + Intergenic
1174563354 20:51446820-51446842 CCCGGGGGGCCACTGACACCAGG + Intronic
1175216532 20:57394322-57394344 CCCCAGGGGACCCATTCACCTGG - Intronic
1175294118 20:57896869-57896891 CCTGTGGGGCCCCATCCACCGGG - Intergenic
1175944776 20:62553613-62553635 CCCGGGAGGCAGCCTTCACCAGG + Exonic
1176260541 20:64177492-64177514 CCTGGGGGGCCACAGTCACAGGG - Intronic
1178534847 21:33403197-33403219 CCCGCGGGGCTCCAGTCTCCAGG + Exonic
1179209438 21:39313222-39313244 CCCGCGGGCCCGCACTCACCTGG + Exonic
1183721992 22:39567980-39568002 CCGAGCGGGCCCCATTCTCCTGG + Intergenic
949811940 3:8015771-8015793 CTCTGGGGACCCCATCCACCTGG + Intergenic
950649922 3:14401048-14401070 CCCGGGTGGCCCCTTCCTCCAGG - Intergenic
968522867 4:1042099-1042121 CCTGGGGGCCCCCACCCACCAGG + Intergenic
968745897 4:2359934-2359956 CCTGGGGACCCCCATCCACCTGG + Intronic
968914955 4:3493345-3493367 CCTGGGGGGCCTCCATCACCAGG - Exonic
988610040 5:32714400-32714422 CCCGGGGCGCACCAGTCCCCAGG - Intronic
998368428 5:141645905-141645927 GCCGGGCAGCCCCCTTCACCTGG + Exonic
999368497 5:151038535-151038557 CCCTGGGGGCCCCATCTCCCTGG + Intronic
1003985173 6:11428030-11428052 CCGGGTGGGCCCCATTCCCACGG - Intergenic
1013230489 6:108157691-108157713 CGCGGGGCGCCCCATTGACTGGG - Intronic
1023623878 7:42097498-42097520 CCCGGGAGCCCCCCTTCCCCTGG + Intronic
1026983208 7:74538454-74538476 TCTGGGGGGCCTCAGTCACCGGG + Intronic
1028376358 7:90149583-90149605 CCCTGGGGGCCCCACTCACCTGG + Intergenic
1028393416 7:90340569-90340591 TCAAGGGGGCCCCATTCACAAGG + Intronic
1032195513 7:129786200-129786222 CCAGGGTGGCCCCACTCCCCAGG - Intergenic
1034470314 7:151251414-151251436 CGTGGTGGGCCCCATTCACAAGG + Intronic
1035203843 7:157282125-157282147 CCCCGAGGACCCCACTCACCTGG + Intergenic
1035295674 7:157865752-157865774 CCCAGGAGGGCCCATTCACCTGG - Intronic
1049173534 8:141177043-141177065 CCCGGGAGGCCCCACTCTCTGGG - Intronic
1053422430 9:37987943-37987965 CCCTGGGGGCCCTGGTCACCTGG + Intronic
1058265354 9:102891897-102891919 CCGGGAGGGCACCTTTCACCTGG + Intergenic
1059268849 9:113060259-113060281 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059269985 9:113065708-113065730 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059271119 9:113071156-113071178 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059272252 9:113076602-113076624 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059273387 9:113082044-113082066 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059274523 9:113087490-113087512 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1061887474 9:133599058-133599080 CCCTGGGGGCACCTTCCACCTGG + Intergenic
1061975855 9:134067806-134067828 CCCCGGGCGCCCGGTTCACCCGG + Intronic
1062116806 9:134814016-134814038 ACCGGGGGGCCGCCTTCTCCCGG - Exonic
1203774062 EBV:63038-63060 CCCGGGGGTCCGAATTCACGCGG + Intergenic
1185433652 X:24491-24513 ACCAGGGTGCCCCATTCCCCCGG - Intergenic
1185442857 X:236559-236581 ACCAGGGTGCCCCATTCCCCCGG - Intergenic
1187319454 X:18226845-18226867 CCCGGGGGGTCCATCTCACCAGG + Intergenic
1188005459 X:25013391-25013413 CCCGGGGGGCGTCACGCACCCGG - Exonic
1190402191 X:50048356-50048378 CCAGGGGGTCCCCATCCACGGGG - Intronic
1190781503 X:53600579-53600601 CCCAGGGGGTACCATTCACATGG + Intronic