ID: 921207166

View in Genome Browser
Species Human (GRCh38)
Location 1:212858594-212858616
Sequence TCCCGGGGGGCCCCATTCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207166_921207179 11 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207166_921207176 7 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207166_921207175 6 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207166_921207177 10 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207166_921207173 -2 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207173 1:212858615-212858637 GACAGCCTCGCTGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 158
921207166_921207172 -3 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207172 1:212858614-212858636 GGACAGCCTCGCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 107
921207166_921207181 27 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207181 1:212858644-212858666 GGGCGGGCCTCAGACTCCACTGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207166 Original CRISPR TCCCGGGGGGCCCCATTCAC CGG (reversed) Exonic
900550113 1:3250343-3250365 TCCCGCAGGGGCCCCTTCACAGG + Intronic
902748172 1:18487353-18487375 TCCAGGGGCACCACATTCACTGG + Intergenic
903824177 1:26130803-26130825 GCCCAGGGGGACCCAATCACAGG + Intergenic
903839018 1:26225261-26225283 TCCCGGGGCTGCCCACTCACTGG - Intergenic
906513361 1:46424036-46424058 TCCCGGAGGCCCCCAGCCACAGG + Intergenic
916174999 1:162030746-162030768 TTCTCAGGGGCCCCATTCACAGG - Intergenic
921207166 1:212858594-212858616 TCCCGGGGGGCCCCATTCACCGG - Exonic
921263519 1:213404140-213404162 TCAAGGTGGGCCCCACTCACTGG - Intergenic
922280012 1:224114470-224114492 TCGCGGGGGGCTCCCTTCCCGGG - Intronic
922775946 1:228214252-228214274 TCCCGGTGGGCCCCGTCCACTGG + Exonic
922806842 1:228394689-228394711 TCCAGGAGGGCCCGAGTCACTGG + Exonic
923920211 1:238555464-238555486 TCCCCTGGGGCCCCAGTTACTGG + Intergenic
1067661017 10:48236284-48236306 TCACGTGGGGCCCCTTTAACAGG + Intronic
1075721126 10:124588057-124588079 TCCAGGCAGGCCACATTCACAGG + Intronic
1076451803 10:130561449-130561471 TTCCTGGGGTCCCCATTCTCGGG + Intergenic
1083935254 11:65866690-65866712 GCCCAGGGGCCCCCATTGACAGG - Exonic
1091453280 12:586881-586903 CCACGGGGGACGCCATTCACTGG + Intronic
1096252535 12:50042220-50042242 CTCCGGGGCGCACCATTCACAGG - Intergenic
1097186461 12:57198974-57198996 TCCCGAGGGGAGCCATACACTGG + Intronic
1104993563 12:132640488-132640510 TTCCGGGGGGCCCTGGTCACAGG + Intronic
1106241341 13:27916075-27916097 TGCCTGGGGGCCCCACTCCCAGG + Intergenic
1106670833 13:31903319-31903341 TCTCCAGGGGCCCCAGTCACTGG - Intergenic
1113274434 13:108712754-108712776 CCCCGGGTGTCCCCATGCACTGG - Intronic
1115938068 14:38577760-38577782 TCCCAGGAAGCCCCATTCATAGG - Intergenic
1117637022 14:57754597-57754619 TCTCGGGAGGCTCCATGCACGGG - Intronic
1119702270 14:76763023-76763045 TCCCAGGTGGCCTCATCCACAGG - Exonic
1122665659 14:103327747-103327769 GCCCGGGGGGCGCCAGACACTGG - Intergenic
1129601497 15:77001409-77001431 TCCAGCAGGGCCCCATCCACAGG - Intronic
1132534458 16:471195-471217 TCCCTGGGGGCCTCCTTCCCAGG + Intronic
1134106435 16:11488795-11488817 TCCCGGAGGGCCCGTTTCAGGGG + Exonic
1134782887 16:16914678-16914700 TCCAGGGGGGCTCCAGTTACAGG - Intergenic
1141592477 16:85077828-85077850 TCCCTGGGGGCCACACTCCCTGG + Intronic
1142300458 16:89254816-89254838 TCCCGGGAAGACCCACTCACAGG - Intergenic
1143894255 17:10124091-10124113 CCTCAGGGGCCCCCATTCACGGG - Intronic
1147951273 17:44109364-44109386 TGCCTGGGGGCCCCCTACACAGG - Intronic
1152159406 17:78658086-78658108 TCCCAGGGGGCTGCTTTCACAGG + Intergenic
1152892426 17:82890204-82890226 ACCTGGGGCCCCCCATTCACAGG - Intronic
1153625472 18:7018956-7018978 CCACGAGAGGCCCCATTCACCGG + Intronic
1157597768 18:48874387-48874409 TCCCTTGAGGTCCCATTCACAGG + Intergenic
1157711214 18:49850921-49850943 GCCCTGGGCTCCCCATTCACTGG - Intronic
1160456660 18:79006585-79006607 TCCCGGGTGGGCCCATTGCCCGG + Intergenic
1161309485 19:3585974-3585996 TCCCGGGGTGCCACACTCCCAGG + Intronic
1161703045 19:5805277-5805299 GCCCGGGGGGCCCCATGGGCCGG + Intergenic
1161795132 19:6381943-6381965 TCCTGGGGGGCCTCACTGACTGG + Intronic
1162336191 19:10061978-10062000 TCCCGGGGGTCCCCATCACCTGG - Intergenic
1162348753 19:10136383-10136405 CCCCAGGGGGCCCCTTGCACAGG - Intronic
1162353366 19:10165323-10165345 CCCCAGGGGGCCCCTTGCACAGG - Intronic
1162906639 19:13827791-13827813 TCCCCTGAGGCCCCATCCACAGG - Intronic
1165443735 19:35845496-35845518 CCCCGGAGAGCCCCATTCAAAGG - Exonic
1166518533 19:43464305-43464327 GCCCGGGGGTCCCCACTCACTGG + Exonic
1166791278 19:45400193-45400215 TCCCTAGGGTCCCCATTCAGTGG + Intronic
1166838474 19:45681894-45681916 TCCCGGCTGGCCTCATTCCCAGG - Exonic
1166853536 19:45771371-45771393 TCACGGGGGTCCCCAGTCCCCGG - Exonic
1167261784 19:48462893-48462915 TCCCGGGGGCCTCAAGTCACAGG - Intronic
928169077 2:28991886-28991908 CCCCGGGTCGCCCCATTCCCTGG + Intronic
929234283 2:39590064-39590086 TCCCGGATGGCCTCATTCATAGG + Intergenic
933797379 2:85930501-85930523 TTCCTGGGGGACCCATTCCCTGG - Intergenic
935641498 2:105294899-105294921 TCCAGGGGGGCCACATTCCAAGG - Intronic
936530218 2:113271179-113271201 GCACTGGGGGCCCCATCCACAGG - Intronic
937221535 2:120345403-120345425 TCCCTGGGCGCCGCATCCACGGG - Intergenic
948569159 2:238906721-238906743 TCCAGGGAGGCCCCAGGCACTGG - Intronic
1170741127 20:19057363-19057385 TCCCAGGAAGCCCCATTCCCAGG + Intergenic
1175294120 20:57896870-57896892 GCCTGTGGGGCCCCATCCACCGG - Intergenic
1175882066 20:62265493-62265515 TCCCCAGGGAGCCCATTCACTGG + Intronic
1176086501 20:63297670-63297692 TCCCCGGGGTCCGCAGTCACAGG - Intronic
1176260543 20:64177493-64177515 CCCTGGGGGGCCACAGTCACAGG - Intronic
1183530554 22:38351210-38351232 GCCTGGGGTGCCCCCTTCACTGG + Intronic
1184272417 22:43392406-43392428 TCCCAGGGAGCCCCATGCACTGG - Intergenic
1184843120 22:47064074-47064096 TCCAGGGAGGCCACGTTCACAGG + Intronic
969575255 4:8032881-8032903 TCCCCGGGGGCCTCTTTCTCTGG - Intronic
969865927 4:10077090-10077112 ACCACGGGGGCCCCATGCACAGG - Intronic
977908044 4:102500504-102500526 TCCCAGTGGCCACCATTCACTGG - Intergenic
982206483 4:153000834-153000856 TCCTGGGAGGCCTCATTGACTGG + Intergenic
983783211 4:171699108-171699130 TTCCAGGGTGCCCCATTCCCTGG + Intergenic
985550863 5:532949-532971 TCCCGGAGGCCCCCATTCATGGG + Intergenic
985595256 5:784987-785009 CCCCGGGGGGCCCCAGAGACAGG - Intergenic
992104396 5:73437579-73437601 TCCCGGGGCCCTCCATCCACGGG - Intergenic
1002764209 6:225648-225670 TCCCGGGTGGCCACAGCCACAGG - Intergenic
1003848146 6:10195399-10195421 TCCCGGGGGACTCCAGCCACAGG + Intronic
1007252448 6:40505168-40505190 TCCCGGGAGACCCCACTGACAGG - Intronic
1007384537 6:41511824-41511846 TCCTGGAGGACCTCATTCACAGG - Intergenic
1013230490 6:108157692-108157714 CCGCGGGGCGCCCCATTGACTGG - Intronic
1018380026 6:163250373-163250395 TGCTCGGGGGCCCCATGCACCGG + Intronic
1020116954 7:5481446-5481468 TCCCTGGGGGCCCTGTCCACGGG - Exonic
1022321577 7:29293187-29293209 TGCCTAAGGGCCCCATTCACTGG + Intronic
1025615817 7:63114844-63114866 TCCCGGGCGGCCCCATGGAGGGG + Intergenic
1038556962 8:28527758-28527780 TCCGGGGATGCCCCATGCACTGG - Exonic
1043545202 8:81307151-81307173 TCCCAGGAGGCCCCATTCCCAGG + Intergenic
1046727409 8:117690530-117690552 TCCCGCGGGGCTCCTTTCATGGG - Intergenic
1049173536 8:141177044-141177066 CCCCGGGAGGCCCCACTCTCTGG - Intronic
1053290657 9:36877792-36877814 TCACGGGGAGTCACATTCACAGG - Intronic
1062389759 9:136329281-136329303 TCCCGGGGGGACCTCGTCACAGG - Intronic
1190402193 X:50048357-50048379 ACCAGGGGGTCCCCATCCACGGG - Intronic