ID: 921207168

View in Genome Browser
Species Human (GRCh38)
Location 1:212858608-212858630
Sequence CGGCAGCGAGGCTGTCCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207168_921207175 -8 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207168_921207181 13 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207181 1:212858644-212858666 GGGCGGGCCTCAGACTCCACTGG 0: 1
1: 0
2: 1
3: 12
4: 149
921207168_921207183 25 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207183 1:212858656-212858678 GACTCCACTGGCCCCAGAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 165
921207168_921207179 -3 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207168_921207176 -7 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207168_921207177 -4 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207168 Original CRISPR CGGCAGCGAGGCTGTCCCGG GGG (reversed) Exonic
903360194 1:22772196-22772218 GAGCAGCCAGGCTGGCCCGGAGG + Intronic
906770631 1:48479539-48479561 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
908584178 1:65550527-65550549 CGGCAGCGAGGCTGGGGCAGGGG - Intronic
909957758 1:81800965-81800987 CGGCCGCAGGGCTGTCCGGGCGG - Intronic
910949972 1:92635385-92635407 CGGCAGCGAGGCTGCAGCGGGGG - Intronic
912266154 1:108160111-108160133 CGGCAGCCACCCTGTCCGGGAGG - Intronic
912316989 1:108675871-108675893 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
914435310 1:147654199-147654221 CGGCAGCCACGTTGTCCAGGAGG + Exonic
916120479 1:161524569-161524591 CAGCAGTGAGGCTCTCCCTGCGG - Exonic
916130243 1:161606201-161606223 CAGCAGTGAGGCTCTCCCTGCGG - Intronic
916816097 1:168354446-168354468 CGGCAGCGAGGCTGGGGCAGGGG - Intergenic
921207168 1:212858608-212858630 CGGCAGCGAGGCTGTCCCGGGGG - Exonic
921566180 1:216723506-216723528 CGGCTGCGCGGCTGGGCCGGTGG - Intronic
922197472 1:223372254-223372276 CGGCAGCGAGGCTGACGGAGGGG - Intergenic
922459402 1:225803362-225803384 GGGCAGCGAGGCAGTCTCTGAGG - Intergenic
922480530 1:225937567-225937589 GGGCAGCGAGGCAGTCTCCGAGG + Exonic
922693182 1:227711046-227711068 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1063744960 10:8869221-8869243 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1067339806 10:45391960-45391982 CGGCAGCCACCCTGTCCGGGAGG + Intronic
1068005997 10:51392973-51392995 CGGCAGCTACCCTGTCCGGGAGG - Intronic
1069772319 10:70907646-70907668 TGGCAGGGAGGCTGTCTGGGTGG + Intergenic
1071476785 10:86032224-86032246 CGGCAGCCACCCTGTCCTGGAGG + Intronic
1072684611 10:97528959-97528981 CGGCAGCCACCCTGTCCGGGAGG - Intronic
1072891619 10:99329766-99329788 CTGCAGCGCTGCGGTCCCGGGGG - Exonic
1077435290 11:2536016-2536038 CTGGACCAAGGCTGTCCCGGGGG - Intronic
1080592463 11:33736082-33736104 CGGGTGCGAGGCTGCCCCCGAGG + Intronic
1081672839 11:44951028-44951050 CCCCCGCGAGGCTCTCCCGGGGG + Intronic
1083442806 11:62688127-62688149 CGGCAGCGAGGCTGCGCAGAAGG - Exonic
1083791612 11:64989601-64989623 CGGCAGCCATGTTGTCCCTGTGG + Exonic
1083803419 11:65059520-65059542 GGGAAGGGAGGCTGTCCCAGAGG + Intergenic
1084316984 11:68351316-68351338 CGGAACAGAGGCTGCCCCGGAGG - Intronic
1085139662 11:74129190-74129212 CGGCAGCCACCCCGTCCCGGAGG - Intronic
1089510119 11:118991632-118991654 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1091550283 12:1530969-1530991 CGGCGGCGGGGCCGTCCCCGGGG - Intronic
1095059554 12:37666304-37666326 CGGCAGCGAGGCTGTGGGAGGGG - Intergenic
1095068805 12:37815033-37815055 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1096039448 12:48500821-48500843 CGGCCGCGACCCTGTCTCGGAGG - Intergenic
1103203607 12:119110532-119110554 CGGCAGCGAGGCTGGGGCAGGGG - Intronic
1103234511 12:119360406-119360428 CGGCAGCCACCCTGTCCGGGAGG - Intronic
1103563546 12:121804480-121804502 CGGCAGCGAGGGGCTCCCGGGGG - Intronic
1104768661 12:131346483-131346505 CTGCAGCTGGGCTGTCCTGGTGG - Intergenic
1104811363 12:131622107-131622129 CTGCAGCTGGGCTGTCCTGGGGG + Intergenic
1104901002 12:132189582-132189604 CAGCGTCGACGCTGTCCCGGCGG + Intergenic
1105542297 13:21326253-21326275 CGGCAGTGAGGCTGCCCTGGAGG + Intergenic
1112561735 13:100521326-100521348 CGGCAGCGGGGCTGGACGGGTGG + Intronic
1113792345 13:113035602-113035624 CGGCCACGAAGCTGTCCTGGGGG - Intronic
1113804974 13:113107253-113107275 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805001 13:113107321-113107343 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805013 13:113107355-113107377 CGGGAGTGTGGGTGTCCCGGAGG + Intronic
1113805027 13:113107389-113107411 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805039 13:113107423-113107445 CGGGAGTGTGGGTGTCCCGGAGG + Intronic
1113805053 13:113107457-113107479 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805067 13:113107491-113107513 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805079 13:113107525-113107547 CGGGAGTGTGGGTGTCCCGGAGG + Intronic
1113805093 13:113107559-113107581 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805105 13:113107593-113107615 CGGGAGTGTGGGTGTCCCGGAGG + Intronic
1113805119 13:113107627-113107649 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805133 13:113107661-113107683 CGGGAGCGTGGGTGTCCCGGGGG + Intronic
1113805147 13:113107695-113107717 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805161 13:113107729-113107751 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805198 13:113107831-113107853 CGGGGGCGTGGGTGTCCCGGGGG + Intronic
1113805206 13:113107848-113107870 CGGGGGCGTGGGTGTCCCGGGGG + Intronic
1113805272 13:113108035-113108057 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805343 13:113108239-113108261 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805351 13:113108256-113108278 CGGGGGCGTGGGTGTCCCGGGGG + Intronic
1113805387 13:113108359-113108381 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805409 13:113108410-113108432 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805431 13:113108478-113108500 CAGGAGCGTGGGTGTCCCGGAGG + Intronic
1113805445 13:113108512-113108534 CGGGAGCGTGGGTGTCCCGGGGG + Intronic
1113805459 13:113108546-113108568 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805471 13:113108580-113108602 CGGGAGTGTGGGTGTCCCGGAGG + Intronic
1113805557 13:113108819-113108841 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805593 13:113108921-113108943 CGGGAGCGTGGGTGTCCCGGGGG + Intronic
1113805606 13:113108955-113108977 CGGGAGCGTGGGTGTCCCAGGGG + Intronic
1113805628 13:113109006-113109028 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805663 13:113109108-113109130 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1113805677 13:113109142-113109164 CGGGAGTGTGGGTGTCCCGGGGG + Intronic
1117910976 14:60637900-60637922 CGGCGGCGAAACTGGCCCGGAGG + Intergenic
1118423557 14:65633821-65633843 CGGCAGCCACCCTGTCCGGGAGG + Intronic
1118723562 14:68610510-68610532 CGGCAGTGAGGTTGTACGGGAGG - Intronic
1119767629 14:77200360-77200382 CTGCAGGGAGGCTGTGCCGAGGG - Intronic
1120309861 14:82814442-82814464 CGGCAGCCACCCCGTCCCGGAGG - Intergenic
1122967355 14:105137645-105137667 CGGCAGCTAGGCGGCACCGGGGG - Intergenic
1124129364 15:26971120-26971142 CGCCTCCGAGGCGGTCCCGGCGG - Intergenic
1125508735 15:40281878-40281900 CGGCGGCGAGGCTGGCTCAGCGG - Exonic
1126057004 15:44739659-44739681 CGGCAGCGAGGCTGTGGGAGGGG + Intronic
1131278483 15:91002092-91002114 CGGCTGTGAGGGTGTCCCCGGGG + Exonic
1131916440 15:97271163-97271185 CGGCAGCGAGGCTGGCAGAGGGG - Intergenic
1132512605 16:352057-352079 CGGGAGTCCGGCTGTCCCGGAGG - Intronic
1132615476 16:839428-839450 CAGCAGAGGGGCTGGCCCGGAGG - Intergenic
1133011097 16:2912210-2912232 CCGCAGCCCGGCTCTCCCGGGGG + Intronic
1133225823 16:4339945-4339967 CGGCAGCCACCCTGTCCCTGGGG - Intronic
1134043250 16:11083804-11083826 AGGCAGGGAGGCTGGCCCAGGGG + Intronic
1136155175 16:28377453-28377475 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1136207934 16:28737886-28737908 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1136419312 16:30122448-30122470 GGGCAGCGGGGCTGTCCCAGAGG + Intronic
1138122563 16:54412272-54412294 AGGCAGCGAGGCTGTTCGGCTGG - Intergenic
1141649524 16:85385611-85385633 CAGCAGCCAGGCTGGCCCTGGGG - Intergenic
1142030698 16:87837045-87837067 CGGGAGCACGGCTGTGCCGGGGG - Intronic
1142656816 17:1399935-1399957 CGTCTGCGAGCCTGGCCCGGGGG - Intronic
1143016260 17:3892706-3892728 CCGCGGCGATGCGGTCCCGGCGG + Intronic
1143115277 17:4578453-4578475 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1144754750 17:17672379-17672401 CAGCAGCTCGGCTGTCCTGGTGG + Intergenic
1145896171 17:28459064-28459086 CGGCAGCCACCCTGTCCGGGAGG + Intronic
1148407009 17:47424199-47424221 CGGCAGCCAGGCTGTGCAGGGGG + Intronic
1148553791 17:48565805-48565827 GGGAAGGGAGGCTGTCCTGGAGG - Intronic
1151218302 17:72592588-72592610 TGGCAGAGAGGCTTTCCCGGCGG - Intergenic
1152111400 17:78359479-78359501 CGGCGCCCAGGCAGTCCCGGGGG - Intronic
1152198823 17:78933498-78933520 AGGCAGAGAGGTTGTCCTGGTGG + Intergenic
1152284275 17:79403326-79403348 CGGCAGCAGGGCTGCCCCTGAGG + Intronic
1152814482 17:82399349-82399371 GGGCAGCGAGGCTGGCACCGGGG - Intronic
1154181149 18:12141060-12141082 CGGCAGCGAGGCTGGCGGAGGGG - Intergenic
1158725726 18:59969753-59969775 CGGCAGCCAGGCTGTGCAGGGGG + Intergenic
1160991073 19:1860571-1860593 TGGCTGCAGGGCTGTCCCGGGGG - Intronic
1161437610 19:4273134-4273156 CAGCAGCCAGGCAGCCCCGGAGG - Intergenic
1163369949 19:16896409-16896431 CAGCAGCGATGGTGTCCCCGAGG + Intronic
1163442615 19:17329348-17329370 GGGCAGCGTGGCTGTGCTGGGGG - Intronic
1163674207 19:18647242-18647264 CGACAAGGAGGCCGTCCCGGGGG - Intronic
1163689677 19:18731793-18731815 CGGCTGCCTGGCTGCCCCGGGGG + Intronic
1164435191 19:28222708-28222730 GGGCAGTGAGGCTGTCACTGGGG - Intergenic
1165433835 19:35786450-35786472 CAGCAGCGACGCTTTCCCTGTGG + Intronic
1168136637 19:54356291-54356313 CGGCCGCCAGGCTGCCCCTGAGG - Intronic
927125121 2:20006715-20006737 TGGCAGTGAGGCTGTCCCTGAGG - Intronic
928558108 2:32447848-32447870 CGGCAGCGACCCCGTCCGGGAGG - Intronic
930615317 2:53587441-53587463 CGGCAGCGAGGCTGGGCGAGGGG + Intronic
930727876 2:54699121-54699143 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
930798701 2:55420062-55420084 CGGCGGCGAGGCTAGCCCGGGGG - Intergenic
934549101 2:95243691-95243713 CGGCAGCCACCCTGTCCGGGAGG + Intronic
940401875 2:153257038-153257060 CGGCAGCGAGGCTGGCGGAGGGG - Intergenic
942096193 2:172538012-172538034 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
945316658 2:208377607-208377629 CAGCAGCCACCCTGTCCCGGAGG - Intronic
949019932 2:241735217-241735239 CGGCGGCGATGCTGCCCCGTCGG + Exonic
1168998232 20:2148099-2148121 CAGCAGGGAGGCCGTCCCGCTGG + Exonic
1171366117 20:24626230-24626252 CGGCAGCCACCCTGTCCGGGAGG - Intronic
1172141205 20:32724015-32724037 CGGCAGCCACCCTGTCCGGGAGG + Intronic
1172199623 20:33115763-33115785 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1172379228 20:34474810-34474832 CGGCAGCCACCCTGTCCGGGAGG - Intronic
1172918553 20:38461695-38461717 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1172918596 20:38461852-38461874 CGGCCGCGACCCTGTCCGGGAGG - Intergenic
1175811298 20:61859777-61859799 CGGCAGCGAAGCTGGCCGTGAGG - Intronic
1176546647 21:8205222-8205244 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1176554542 21:8249412-8249434 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1176565598 21:8388269-8388291 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1176573463 21:8432437-8432459 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1178903566 21:36616955-36616977 CGGCAGCGAGGCTGGAGTGGGGG + Intergenic
1179407162 21:41135857-41135879 CAGCAGCCAAGCTGTCCTGGGGG - Intergenic
1181437406 22:22918726-22918748 TGGCAGCCTGCCTGTCCCGGGGG - Intergenic
1183186616 22:36295116-36295138 CTGGAGCGAGGCTGTCCCTGGGG + Intronic
1184718748 22:46296950-46296972 CGGGGGCGAGGCTTGCCCGGTGG + Intronic
1203236021 22_KI270732v1_random:2154-2176 CGGCAGCGAGGCTGGGGCAGTGG + Intergenic
1203251512 22_KI270733v1_random:121488-121510 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1203259562 22_KI270733v1_random:166570-166592 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
949988778 3:9560233-9560255 CGGCAGCCAGCCCGTCCGGGAGG + Intergenic
952347545 3:32502664-32502686 AGGCAGCGAGGCCGCTCCGGGGG + Exonic
952852149 3:37738323-37738345 CGGCAGTGAGGCTGTCCATGGGG + Intronic
956487763 3:69740039-69740061 GGGCCGGGACGCTGTCCCGGTGG + Intronic
961535974 3:127570863-127570885 CGTCAGTGAGGATGTGCCGGTGG + Intergenic
961729235 3:128954486-128954508 CGGCAGCCACCCTGTCCGGGAGG + Intronic
961960533 3:130849534-130849556 TGTCAGGGAGGCTGTCCAGGGGG + Intergenic
961962414 3:130868092-130868114 CGGCAGCCACCCCGTCCCGGAGG + Intronic
962761389 3:138518117-138518139 CGGCAGCGAGGCTGTGGGAGGGG + Intronic
963939483 3:151085532-151085554 CGGCGCCGAGGCTGGCCCTGGGG - Intergenic
964696271 3:159511174-159511196 CGGCAGCGAGGCTGGGCGAGGGG - Intronic
965295618 3:166942594-166942616 GGGCAGGGAGGCTGTGCTGGGGG - Intergenic
967847895 3:194058461-194058483 CCGCCGCGAGGCTGAGCCGGTGG + Intergenic
984966249 4:185143092-185143114 CGGGAGCGAGGCTGGGCCGGGGG - Intergenic
985542650 5:493980-494002 AGGGAGGGAGGCTGTCCCTGGGG + Intronic
990293927 5:54381583-54381605 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
990708575 5:58557843-58557865 CGGCAGCGAGGCTGTGGGAGGGG - Intronic
991672618 5:69063006-69063028 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
993900933 5:93584150-93584172 CGGCGCCGCCGCTGTCCCGGCGG - Exonic
994160897 5:96555660-96555682 CGGCAGCGAGGCTGACGGAGGGG + Intronic
998239466 5:140427790-140427812 CGGCAGCCACCCTGTCCGGGAGG - Intronic
999604161 5:153296936-153296958 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
999727103 5:154446285-154446307 CTGCAGCGGGGGTGTCCGGGAGG - Exonic
1001688694 5:173616211-173616233 CGTCGGCCAGGCAGTCCCGGCGG + Exonic
1002234110 5:177791875-177791897 CGGCAGCGAGGCTGGGCGAGGGG - Intronic
1003120191 6:3313014-3313036 GGCCAGTGTGGCTGTCCCGGGGG - Intronic
1005854477 6:29850436-29850458 CGGCGGTGGGGCTGTCCCGCCGG + Intergenic
1006067495 6:31472633-31472655 AGGCAGGGAGGCCTTCCCGGTGG - Intergenic
1006143625 6:31945531-31945553 GGGCAGCGAGGCAGTCCTGCTGG - Exonic
1007088804 6:39169183-39169205 TGGCAGCGTGACTGTCCCTGAGG - Intergenic
1008673570 6:53796128-53796150 CGGCTGCAAGGCTGGCCCGCGGG - Intronic
1008915778 6:56785422-56785444 CGGCAGCGAGGCTGGCGGAGGGG - Intronic
1009282435 6:61769614-61769636 CGGCAGCGAGGCTGGGGGGGCGG + Intronic
1011476090 6:87751238-87751260 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1019272359 7:157335-157357 CGAAAGCAAGGCTGTCCCCGTGG - Intergenic
1019448593 7:1084284-1084306 CGCCAGCGATGCCCTCCCGGGGG + Intronic
1019598638 7:1870127-1870149 CGGCAGGAAGGCTGTGCAGGTGG + Intronic
1019626959 7:2020627-2020649 TGGGAGGGAGGCTGACCCGGTGG + Intronic
1019900969 7:4020371-4020393 CGGCAGCGTGGCTGGCTGGGAGG - Intronic
1020275494 7:6622254-6622276 CGGCGGAGCGGCGGTCCCGGGGG + Exonic
1021992730 7:26152933-26152955 CGGCAGCCAGGCTGTGCAGGGGG + Exonic
1024357059 7:48424928-48424950 CTGCAGGCAGGCTGTCCGGGAGG - Intronic
1025272704 7:57540002-57540024 CGGCAGCGAGGCTGTGGGAGGGG + Intergenic
1027186262 7:75972547-75972569 CCGCATAGAGGATGTCCCGGTGG + Intronic
1027371089 7:77509253-77509275 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1027373988 7:77534091-77534113 TGGCAGCCACCCTGTCCCGGAGG - Intergenic
1030692722 7:112551857-112551879 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1033683719 7:143620697-143620719 CGGAAACTGGGCTGTCCCGGAGG - Intergenic
1033700893 7:143836941-143836963 CGGAAACTGGGCTGTCCCGGAGG + Intergenic
1035355914 7:158276161-158276183 GGGCAGAGAGGCTTTCCAGGTGG - Intronic
1036228479 8:6980390-6980412 ACGCAGCCAGGCTGTCCCAGAGG - Intergenic
1036230931 8:6999500-6999522 ACGCAGCCAGGCTGTCCCAGAGG - Intronic
1041244775 8:55879889-55879911 CTGCAGCGCGTCTGGCCCGGAGG - Exonic
1041362906 8:57071435-57071457 CGGCAGCCACCCTGTCCGGGAGG - Intergenic
1041817804 8:61994721-61994743 CGGCAGCGAGGCTGGACGAGGGG + Intergenic
1043039400 8:75242136-75242158 CCTCAGGGAGGCTGTCCAGGAGG + Intergenic
1043119787 8:76308526-76308548 CGGCAGCGAGGCTGGGGCAGGGG + Intergenic
1044546584 8:93466734-93466756 CGGCAGCGAGGCTGGGTGGGTGG + Intergenic
1047615322 8:126558147-126558169 CGGCAGCGAGGCTGGGCAGAGGG + Exonic
1047687252 8:127316402-127316424 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1049201760 8:141343779-141343801 CAGCAGCGGGGCAGTCCTGGGGG + Intergenic
1049604708 8:143523961-143523983 TGGCATCCAGGCTGCCCCGGGGG - Intronic
1053240080 9:36487863-36487885 CTGCAGCAGGGCTCTCCCGGCGG - Intergenic
1055242108 9:74197686-74197708 CGGCAGCCACCCTGTCCGGGAGG + Intergenic
1058447228 9:105064756-105064778 CGGCTCCTAGGCTGTCCCGAGGG + Intergenic
1060369624 9:123057167-123057189 CGGCAGCCACCCTGTCCGGGAGG - Intronic
1061251612 9:129429625-129429647 CGGCAGCGGGGCTGGCTCTGTGG - Intergenic
1061293683 9:129666101-129666123 CGGCAGCGAGGCGGCGCCGCAGG + Exonic
1061583967 9:131554732-131554754 GGGCAGCGAGCCCGCCCCGGAGG + Intergenic
1061635855 9:131908099-131908121 CGGCAGCCACCCTGTCCGGGAGG + Intronic
1061940913 9:133883326-133883348 CGGCAGGGAGGCTGTCTCAACGG - Intronic
1062022936 9:134327547-134327569 CGGCAGCCAGGCTGTCAGGCCGG + Intronic
1062615098 9:137392745-137392767 GGGCACCGAGGCTGTTCCAGGGG + Intronic
1062615105 9:137392766-137392788 GGGCACCGAGGCTGTTCCAGGGG + Intronic
1203467914 Un_GL000220v1:104639-104661 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1203475735 Un_GL000220v1:148611-148633 CGTCAGCCCGGCTGGCCCGGTGG + Intergenic
1187332539 X:18354253-18354275 CGGCAGGGAGGATGCGCCGGAGG + Intronic
1190279292 X:48918778-48918800 CGGCGGCGTGGGGGTCCCGGGGG + Exonic
1190505237 X:51119608-51119630 CGGCAGCCACCCTGTCCAGGAGG - Intergenic
1190891498 X:54572700-54572722 CGGCAGCTACCCTGTCCGGGAGG - Intergenic
1191565018 X:62517520-62517542 CGGCAGCGAGGCTGTGGGAGGGG + Intergenic
1200224763 X:154411458-154411480 CGGCAGCGAGGCCAGCCCCGGGG - Intronic