ID: 921207169

View in Genome Browser
Species Human (GRCh38)
Location 1:212858609-212858631
Sequence GCGGCAGCGAGGCTGTCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207169_921207179 -4 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207169_921207181 12 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207181 1:212858644-212858666 GGGCGGGCCTCAGACTCCACTGG 0: 1
1: 0
2: 1
3: 12
4: 149
921207169_921207176 -8 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
921207169_921207183 24 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207183 1:212858656-212858678 GACTCCACTGGCCCCAGAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 165
921207169_921207177 -5 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207169_921207175 -9 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207169 Original CRISPR GCGGCAGCGAGGCTGTCCCG GGG (reversed) Exonic
900555490 1:3278308-3278330 GGCGCAGCCAGGCTGTCCCTAGG - Intronic
900898914 1:5503776-5503798 GGGGCAGAGAGGCTGCCCCTAGG - Intergenic
902888756 1:19426154-19426176 GGGGCAGCTATGCTGGCCCGAGG + Intronic
903712831 1:25338545-25338567 GCGGCAACGAGCCTGTGCTGTGG - Intronic
907364287 1:53946341-53946363 GCGGGAGCAAGGCTGGGCCGGGG - Exonic
908584179 1:65550528-65550550 GCGGCAGCGAGGCTGGGGCAGGG - Intronic
910949973 1:92635386-92635408 GCGGCAGCGAGGCTGCAGCGGGG - Intronic
913072047 1:115308195-115308217 GCTGCAGAGAGGCTGTCTCAGGG + Intronic
916816098 1:168354447-168354469 GCGGCAGCGAGGCTGGGGCAGGG - Intergenic
917565268 1:176206827-176206849 GCGGCAGCGCTGGTGTCCGGCGG - Exonic
920458190 1:206116832-206116854 GGGGCAGAGAGGGTGCCCCGAGG + Exonic
921207169 1:212858609-212858631 GCGGCAGCGAGGCTGTCCCGGGG - Exonic
922197473 1:223372255-223372277 GCGGCAGCGAGGCTGACGGAGGG - Intergenic
1063841272 10:10075028-10075050 GTGGCAGCGAGGCTGGGCTGTGG - Intergenic
1068339994 10:55688654-55688676 GCGGCAGCGAGGCTGGGGAGGGG - Intergenic
1076667658 10:132102325-132102347 GCTGCACCCAGGTTGTCCCGCGG - Intergenic
1077197293 11:1287833-1287855 GCGGCAGGGAGGCTGCGGCGGGG - Intronic
1077435291 11:2536017-2536039 GCTGGACCAAGGCTGTCCCGGGG - Intronic
1078450289 11:11435974-11435996 GCGGCAGCATGGCTGTCGCCAGG - Intronic
1079286226 11:19135478-19135500 GCGGCAGCGAGGCTGGGGAGGGG + Intronic
1082028820 11:47590598-47590620 GCGGCAGCGAAACTGGCCGGTGG + Exonic
1083796627 11:65020511-65020533 CCCTCAGCGAGCCTGTCCCGGGG - Intronic
1089816773 11:121183049-121183071 GCGCCAGGGAGGCTGTCCCCAGG - Intronic
1091550284 12:1530970-1530992 GCGGCGGCGGGGCCGTCCCCGGG - Intronic
1095059555 12:37666305-37666327 GCGGCAGCGAGGCTGTGGGAGGG - Intergenic
1098320601 12:69239750-69239772 GCGGCCGGGAAGCTGACCCGGGG + Intronic
1103203608 12:119110533-119110555 GCGGCAGCGAGGCTGGGGCAGGG - Intronic
1103563547 12:121804481-121804503 GCGGCAGCGAGGGGCTCCCGGGG - Intronic
1104602309 12:130162210-130162232 GCGCCAGGCGGGCTGTCCCGGGG + Intergenic
1104811362 12:131622106-131622128 GCTGCAGCTGGGCTGTCCTGGGG + Intergenic
1113569187 13:111341885-111341907 GCAGCATCGAGGGGGTCCCGAGG + Intronic
1113653424 13:112053993-112054015 CGGGCAGCGAGGCTGTCCTGCGG - Intergenic
1113805132 13:113107660-113107682 CCGGGAGCGTGGGTGTCCCGGGG + Intronic
1113805444 13:113108511-113108533 CCGGGAGCGTGGGTGTCCCGGGG + Intronic
1113805592 13:113108920-113108942 CCGGGAGCGTGGGTGTCCCGGGG + Intronic
1114618578 14:24081651-24081673 GCCGGGGCGGGGCTGTCCCGGGG - Intronic
1119767630 14:77200361-77200383 CCTGCAGGGAGGCTGTGCCGAGG - Intronic
1122967356 14:105137646-105137668 GCGGCAGCTAGGCGGCACCGGGG - Intergenic
1124500343 15:30223021-30223043 GCGGCGGCGGGGCTCTCCCCGGG - Intergenic
1124743139 15:32315384-32315406 GCGGCCCCGAGGCCGCCCCGGGG + Intergenic
1124743230 15:32315645-32315667 GCGGCGGCGGGGCTCTCCCCGGG + Intergenic
1126057003 15:44739658-44739680 GCGGCAGCGAGGCTGTGGGAGGG + Intronic
1129313131 15:74725970-74725992 GCGGGGGCGGGGCTGCCCCGTGG + Intergenic
1131174536 15:90201549-90201571 GCAGGAGCGACGGTGTCCCGCGG - Exonic
1131916441 15:97271164-97271186 GCGGCAGCGAGGCTGGCAGAGGG - Intergenic
1133024007 16:2979965-2979987 GAAGAAGAGAGGCTGTCCCGGGG + Intronic
1133464793 16:6019313-6019335 GCGGCAGCGCGGCTCGCACGGGG - Intronic
1134043249 16:11083803-11083825 GAGGCAGGGAGGCTGGCCCAGGG + Intronic
1137379645 16:47985591-47985613 GGGGCAGCGAGGCAGGCACGAGG + Intergenic
1142134355 16:88444797-88444819 GCCTCAGCGTGGCTGTCCTGGGG - Intergenic
1142551438 17:742619-742641 GCGGCAGCTAGCCTGGCCAGTGG + Exonic
1143198751 17:5097653-5097675 GCGGAAGCGTGTCTGTCGCGAGG + Intergenic
1143527215 17:7479584-7479606 GCGGCAGCGGGGCCGGGCCGGGG - Intronic
1144205089 17:12974237-12974259 GGGGCCGCGGGGCTGTCCAGGGG - Exonic
1144775466 17:17782694-17782716 GCGGGGGCGGGGCTGTGCCGCGG + Intronic
1144781250 17:17809694-17809716 GCTGCAGGGAGGCCGTCCCAGGG - Intronic
1148323784 17:46771919-46771941 GCGGCGGCGCGGCGGGCCCGAGG - Intronic
1148407008 17:47424198-47424220 GCGGCAGCCAGGCTGTGCAGGGG + Intronic
1152111401 17:78359480-78359502 GCGGCGCCCAGGCAGTCCCGGGG - Intronic
1154181150 18:12141061-12141083 GCGGCAGCGAGGCTGGCGGAGGG - Intergenic
1157301442 18:46482708-46482730 GCGGCAGCCAGGCTGGACCTAGG - Intronic
1158725725 18:59969752-59969774 GCGGCAGCCAGGCTGTGCAGGGG + Intergenic
1160221231 18:76979502-76979524 GCGGCTGCGAGGCTGTCTAGAGG + Intronic
1160944366 19:1634393-1634415 GAGGCAGCCAGGCTGGCCCAGGG - Intronic
1160991074 19:1860572-1860594 GTGGCTGCAGGGCTGTCCCGGGG - Intronic
1161038028 19:2096291-2096313 GCGGCTGCGAGGCGGTGCGGCGG - Exonic
1161939803 19:7395254-7395276 ACGGCGGCGGGGCGGTCCCGAGG + Intronic
1162059344 19:8085487-8085509 GCAGCAGTGAGGCTGTCACCAGG - Exonic
1162931335 19:13959368-13959390 GAGGCAGGGGGGCTGTCCCGGGG - Exonic
1165092198 19:33393213-33393235 GCGTCGGGGAGGCCGTCCCGGGG + Intronic
1165924921 19:39320882-39320904 GCGGGAGGGAGGCGGCCCCGCGG - Intergenic
1167042167 19:47028658-47028680 GCGGCAGAGAGGCTGGTCCCAGG + Intronic
1168686001 19:58350113-58350135 GCAGCAGGGAGGCTGGCCCCAGG - Intronic
928309037 2:30194597-30194619 GCGTCAGGGAAGCTGTCCCCGGG - Intergenic
930615316 2:53587440-53587462 GCGGCAGCGAGGCTGGGCGAGGG + Intronic
930798702 2:55420063-55420085 GCGGCGGCGAGGCTAGCCCGGGG - Intergenic
932306359 2:70706369-70706391 GCGGCGGCGAGGCAGCCTCGGGG + Exonic
940401876 2:153257039-153257061 GCGGCAGCGAGGCTGGCGGAGGG - Intergenic
943060672 2:183038557-183038579 GCGGCGGCGAGGCCATGCCGAGG - Exonic
943140482 2:183975856-183975878 GCGGCAGCGAGGCTGTGGGAAGG + Intergenic
947565575 2:231190886-231190908 GGGGGAGCGAGCCCGTCCCGCGG - Intergenic
948082223 2:235215764-235215786 TCAGCAGAGAGGCTGTCCAGGGG + Intergenic
948419659 2:237849157-237849179 GCGGCAGCGAGGCTGGGAAGGGG - Intergenic
1172447157 20:34999291-34999313 GCGGCACAGAGGGAGTCCCGTGG + Exonic
1173633194 20:44531907-44531929 GCGGGCGCTAGGCTGCCCCGGGG + Exonic
1178544117 21:33479423-33479445 GCGGCCGCGACGCCCTCCCGAGG - Intronic
1179785856 21:43729215-43729237 GAGACAGCCAGGCTGTCCTGTGG + Intronic
1179913659 21:44462919-44462941 GAGGCAGCCAGGCTGTCCCGAGG - Intergenic
1180062063 21:45390662-45390684 TCGGCTGCGAGGCTGTCCCAAGG + Intergenic
1180236077 21:46459646-46459668 GGGGCCGCGCGGGTGTCCCGGGG - Intronic
1180781275 22:18521231-18521253 GCCGCAGGGAGCCAGTCCCGAGG - Intergenic
1181084265 22:20432062-20432084 GAGGCAGGGAGGCTGTGCGGAGG - Intronic
1181238160 22:21460573-21460595 GCCGCAGGGAGCCAGTCCCGAGG - Intergenic
1181571038 22:23767911-23767933 GCGGCAGCGGTGCTGTCGCGGGG + Exonic
1181595559 22:23912290-23912312 TCGGAAGGGAGGCTGTCTCGGGG - Intergenic
1181778831 22:25178514-25178536 GGGGCGGCGGGGCTGTCCCACGG + Intronic
1183186615 22:36295115-36295137 GCTGGAGCGAGGCTGTCCCTGGG + Intronic
1183236702 22:36624210-36624232 GAGGCAGCGGGGATGGCCCGAGG + Intronic
1183951617 22:41355898-41355920 GAGGCAGCGATGCTTTCCAGCGG + Intronic
1184372472 22:44091221-44091243 GCGGCAGCCAGGCTGGCTCGCGG + Intronic
1185061657 22:48610165-48610187 GGGGCAGGGAGGCCTTCCCGTGG + Intronic
950729773 3:14947549-14947571 GCGGCGGCGAGGCTGGCGCTGGG + Intergenic
952852148 3:37738322-37738344 ACGGCAGTGAGGCTGTCCATGGG + Intronic
952889108 3:38029374-38029396 GGGGCAGAGAGGCGGGCCCGGGG + Intronic
954295724 3:49673753-49673775 GCCGCAGCGTGGATCTCCCGCGG - Intergenic
958407512 3:93767357-93767379 GCGGCAGCGAGGCTGGGGTGGGG + Intergenic
960702441 3:120451222-120451244 GAGGCAGAGGGGGTGTCCCGTGG + Exonic
961960532 3:130849533-130849555 GTGTCAGGGAGGCTGTCCAGGGG + Intergenic
962761388 3:138518116-138518138 GCGGCAGCGAGGCTGTGGGAGGG + Intronic
962808894 3:138945768-138945790 GCGGCGGCGCGGCGGCCCCGTGG + Exonic
964696272 3:159511175-159511197 GCGGCAGCGAGGCTGGGCGAGGG - Intronic
965295619 3:166942595-166942617 GGGGCAGGGAGGCTGTGCTGGGG - Intergenic
967956485 3:194881348-194881370 GCGGCACCCAGGCAGGCCCGTGG + Intergenic
974094881 4:57351761-57351783 GAGGCAGCTATGCTGTCCTGGGG + Intergenic
974774586 4:66463058-66463080 GCGGCAGCGAGGCTGGGGGGAGG - Intergenic
984966250 4:185143093-185143115 CCGGGAGCGAGGCTGGGCCGGGG - Intergenic
985542649 5:493979-494001 GAGGGAGGGAGGCTGTCCCTGGG + Intronic
989170710 5:38468579-38468601 GCAGCCACGATGCTGTCCCGTGG + Intergenic
990708576 5:58557844-58557866 GCGGCAGCGAGGCTGTGGGAGGG - Intronic
991291318 5:65035870-65035892 GGGTCCGGGAGGCTGTCCCGGGG + Intergenic
993867601 5:93213562-93213584 GCGGCAGCGAGGCTGGGGAGGGG + Intergenic
994094317 5:95835130-95835152 GCGGCGGCGAGGCAGTCACTGGG - Intergenic
994160896 5:96555659-96555681 GCGGCAGCGAGGCTGACGGAGGG + Intronic
997265127 5:132490841-132490863 GCGCCCGCGCGGCTGTCCGGGGG - Intergenic
1002234111 5:177791876-177791898 GCGGCAGCGAGGCTGGGCGAGGG - Intronic
1003653990 6:7988593-7988615 GTGGCAGCTAGTCTGTCCTGAGG - Intronic
1005239185 6:23804463-23804485 GCAGCAGCGAGGCTGGGGCGGGG + Intergenic
1006509838 6:34515816-34515838 GCAGCAGCGAGTCTGTCCCCAGG - Intronic
1008388481 6:50921540-50921562 GCGGCAGCAAGGCTGTGGAGGGG - Intergenic
1008673571 6:53796129-53796151 GCGGCTGCAAGGCTGGCCCGCGG - Intronic
1008915779 6:56785423-56785445 GCGGCAGCGAGGCTGGCGGAGGG - Intronic
1010428069 6:75748763-75748785 GCGGCAGCGAGGCTGCGTGGCGG - Intergenic
1011517228 6:88166893-88166915 GCGGCAGCGAGCTGGGCCCGGGG + Intergenic
1014943929 6:127475243-127475265 GCGGTGGCCAGGCTGGCCCGTGG - Intronic
1019157825 6:170050888-170050910 GGGGCGGCGAGGCAGTGCCGGGG - Intergenic
1019399780 7:845939-845961 GGTGCTGCGTGGCTGTCCCGGGG + Intronic
1019503006 7:1374707-1374729 GCGGGAGCGAGCCTGTCTTGCGG + Intergenic
1020275493 7:6622253-6622275 GCGGCGGAGCGGCGGTCCCGGGG + Exonic
1021992729 7:26152932-26152954 GCGGCAGCCAGGCTGTGCAGGGG + Exonic
1023255793 7:38311317-38311339 GCGGCAGCGGTTCTGTCGCGGGG - Intergenic
1025272703 7:57540001-57540023 GCGGCAGCGAGGCTGTGGGAGGG + Intergenic
1033757054 7:144404019-144404041 GCGGGAGCGAGGCTACCCGGTGG + Intronic
1041817803 8:61994720-61994742 GCGGCAGCGAGGCTGGACGAGGG + Intergenic
1043119786 8:76308525-76308547 GCGGCAGCGAGGCTGGGGCAGGG + Intergenic
1047615321 8:126558146-126558168 GCGGCAGCGAGGCTGGGCAGAGG + Exonic
1049201759 8:141343778-141343800 GCAGCAGCGGGGCAGTCCTGGGG + Intergenic
1049258171 8:141624887-141624909 GAGGCAGCGAAGCTGTGCTGAGG + Intergenic
1056406697 9:86282227-86282249 GAGGCGGCGAGGCTGTGCGGCGG + Intronic
1057995865 9:99821471-99821493 GCGCCTCCGAGGCTGCCCCGAGG - Intergenic
1058447227 9:105064755-105064777 ACGGCTCCTAGGCTGTCCCGAGG + Intergenic
1059191740 9:112333543-112333565 GCGGCAGCAGGGCGGTTCCGGGG + Intronic
1060825756 9:126687028-126687050 GCGTCAGGGAGGCTGCCCCCAGG + Intronic
1061365893 9:130172376-130172398 GCAGCAGCGAGCATGTGCCGCGG + Intergenic
1061601093 9:131670661-131670683 GAGGCCGGGAGACTGTCCCGAGG - Intronic
1062615097 9:137392744-137392766 GGGGCACCGAGGCTGTTCCAGGG + Intronic
1062615104 9:137392765-137392787 GGGGCACCGAGGCTGTTCCAGGG + Intronic
1062615110 9:137392786-137392808 GGGGCATCGAGGCTGTTCTGTGG + Intronic
1062615130 9:137392852-137392874 GGGGCACCGAGGCTGTTCCAGGG + Intronic
1190279291 X:48918777-48918799 GCGGCGGCGTGGGGGTCCCGGGG + Exonic
1191565017 X:62517519-62517541 GCGGCAGCGAGGCTGTGGGAGGG + Intergenic
1201017590 Y:9622206-9622228 GGGGCAGCGGGGCTGTCACAGGG - Intergenic
1202109135 Y:21403696-21403718 GGGGCAGTGAGGCTGTCACGGGG - Intergenic
1202120139 Y:21512423-21512445 GGGGCAGTGAGGCTGTCACGGGG + Intronic
1202122590 Y:21535964-21535986 GGGGCAGTGAGGCTGTCACGGGG + Intronic
1202156415 Y:21893419-21893441 GGGGCAGTGAGGCTGTCACGGGG - Intronic
1202158863 Y:21916960-21916982 GGGGCAGTGAGGCTGTCACGGGG - Intronic
1202185314 Y:22181875-22181897 GGGGCAGTGAGGCTGTCACGGGG - Intronic
1202197550 Y:22309910-22309932 GGGGCAGTGAGGCTGTCACGGGG + Intronic
1202206046 Y:22404520-22404542 GGGGCAGTGAGGCTGTCACGGGG + Intronic