ID: 921207170

View in Genome Browser
Species Human (GRCh38)
Location 1:212858610-212858632
Sequence GGCGGCAGCGAGGCTGTCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1433
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 1378}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207170_921207183 23 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207183 1:212858656-212858678 GACTCCACTGGCCCCAGAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 165
921207170_921207175 -10 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207170_921207177 -6 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207177 1:212858627-212858649 GCCGCCTCGGGAGTTCTGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 82
921207170_921207179 -5 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207179 1:212858628-212858650 CCGCCTCGGGAGTTCTGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 128
921207170_921207181 11 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207181 1:212858644-212858666 GGGCGGGCCTCAGACTCCACTGG 0: 1
1: 0
2: 1
3: 12
4: 149
921207170_921207176 -9 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207176 1:212858624-212858646 GCTGCCGCCTCGGGAGTTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207170 Original CRISPR GGCGGCAGCGAGGCTGTCCC GGG (reversed) Exonic
900012996 1:132274-132296 GGCGGCAGCAGGGCTGCCCACGG - Intergenic
900043062 1:488261-488283 GGCGGCAGCAGGGCTGCCCACGG - Intergenic
900064498 1:723258-723280 GGCGGCAGCAGGGCTGCCCACGG - Intergenic
900321519 1:2086662-2086684 GGGGGCCGTGAGGCTGTGCCCGG + Intronic
900368848 1:2322641-2322663 CCCGCCAGGGAGGCTGTCCCCGG - Intronic
900474586 1:2870169-2870191 GGCCACAGCGAGGATGTCCCAGG - Intergenic
900927199 1:5713141-5713163 GGGGGCAACAAGGATGTCCCTGG - Intergenic
901417603 1:9128500-9128522 GGCGCCCCCGAGGCTGTCCTGGG - Intronic
901644155 1:10707633-10707655 GGGAGCAGGGAAGCTGTCCCTGG + Intronic
901970712 1:12905540-12905562 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
902581187 1:17408629-17408651 GGCAGCAGCTAGGCAGTCACCGG - Exonic
903732551 1:25507002-25507024 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
904952124 1:34251158-34251180 GGCGGCAGCGAGGCTGCGGGAGG + Intergenic
905393982 1:37655686-37655708 GGCGGGAGCGCGGGGGTCCCGGG - Intergenic
905647213 1:39633051-39633073 GGCGGCGGCGGGGCTGGGCCGGG + Intronic
905981732 1:42235111-42235133 GGCGGCAGCAAGGCTGTGGGAGG - Intronic
906589081 1:47006862-47006884 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
906714485 1:47956638-47956660 GGCGGCAGGGAGGCTGGCGGAGG + Intronic
906737926 1:48150542-48150564 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
906828439 1:49006430-49006452 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
906851638 1:49257384-49257406 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
906853840 1:49282924-49282946 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
907139835 1:52176705-52176727 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
907364288 1:53946342-53946364 GGCGGGAGCAAGGCTGGGCCGGG - Exonic
907853024 1:58274594-58274616 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
907863725 1:58378768-58378790 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
907969781 1:59369340-59369362 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
908555699 1:65254700-65254722 AGCGGCGGCGGGGCCGTCCCCGG + Intronic
908584180 1:65550529-65550551 GGCGGCAGCGAGGCTGGGGCAGG - Intronic
908585580 1:65564141-65564163 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
908665106 1:66481341-66481363 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
908894319 1:68881369-68881391 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
908977065 1:69910910-69910932 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
909216629 1:72899183-72899205 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
909413025 1:75376240-75376262 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
909727291 1:78851037-78851059 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
909778821 1:79516844-79516866 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
910074730 1:83264022-83264044 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
910082338 1:83356026-83356048 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
910636865 1:89418176-89418198 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
910668805 1:89752617-89752639 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
910699935 1:90062876-90062898 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
910714814 1:90219408-90219430 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
910815408 1:91287064-91287086 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
910945692 1:92589548-92589570 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
910949974 1:92635387-92635409 GGCGGCAGCGAGGCTGCAGCGGG - Intronic
910974466 1:92891940-92891962 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
911057473 1:93721013-93721035 GGCTGAGGCGAGGCTGACCCTGG + Intronic
911291062 1:96057293-96057315 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
911394375 1:97287642-97287664 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
911822861 1:102442501-102442523 GGCGGCAGCGAGGCTGCGGGAGG + Intergenic
911996751 1:104775840-104775862 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
912266959 1:108167379-108167401 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
912737174 1:112160389-112160411 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
913054795 1:115148228-115148250 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
913072046 1:115308194-115308216 GGCTGCAGAGAGGCTGTCTCAGG + Intronic
913413032 1:118573813-118573835 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
913436527 1:118852767-118852789 GGCGGCAACGAGGCTGTGGGAGG + Intergenic
913580761 1:120224705-120224727 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
913627418 1:120673694-120673716 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
913704117 1:121401864-121401886 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
913985684 1:143563688-143563710 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
914401728 1:147327375-147327397 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
914562691 1:148836142-148836164 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
914610138 1:149294080-149294102 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
915004502 1:152623635-152623657 GGCGGCAGAGAGGCTGTGGTGGG - Intergenic
915761703 1:158320246-158320268 GGCGGCAGTGAGGCTGAGGCAGG - Intergenic
915861858 1:159453370-159453392 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
916154647 1:161832688-161832710 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
916333635 1:163645604-163645626 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
916342859 1:163755827-163755849 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
916373585 1:164126665-164126687 GGTGGCAGCGAGGCTGTGGGAGG - Intergenic
916402054 1:164459619-164459641 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
916816099 1:168354448-168354470 GGCGGCAGCGAGGCTGGGGCAGG - Intergenic
917093137 1:171373968-171373990 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
917126996 1:171695983-171696005 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
917259737 1:173154148-173154170 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
917398057 1:174615791-174615813 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
917398302 1:174618075-174618097 GGCAGCAGCGAGGCTGTGGGAGG + Intronic
917547953 1:175992674-175992696 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
917549359 1:176007932-176007954 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
917575163 1:176313968-176313990 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
917671616 1:177278750-177278772 GGCGGAAGCGAGGCTGGCGATGG - Exonic
917684942 1:177406507-177406529 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
917705914 1:177634335-177634357 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
917774627 1:178320381-178320403 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
917827411 1:178837961-178837983 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
918235911 1:182580820-182580842 GGAGGCAGCCAGGCTGTACCTGG + Intronic
918468492 1:184846027-184846049 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
918506255 1:185257369-185257391 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
918563090 1:185892899-185892921 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
918785487 1:188757822-188757844 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
918833774 1:189432911-189432933 GGCAGCAGGAAGGCTGACCCTGG - Intergenic
919375309 1:196786517-196786539 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
919796192 1:201322848-201322870 GGGTGCAGCGGGGCTGTCCTGGG + Intronic
920048166 1:203146969-203146991 GGTGGCAGAGAGGGTCTCCCTGG - Intronic
920890325 1:209978913-209978935 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
921207170 1:212858610-212858632 GGCGGCAGCGAGGCTGTCCCGGG - Exonic
921243714 1:213214309-213214331 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
921844478 1:219863983-219864005 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
921872117 1:220152442-220152464 TGAGGCAGGGAGGCTGGCCCGGG - Intronic
922172570 1:223168031-223168053 GGCGGCAGCGAGGCTGGGGTAGG + Intergenic
922197474 1:223372256-223372278 GGCGGCAGCGAGGCTGACGGAGG - Intergenic
922200971 1:223401121-223401143 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
922206046 1:223447407-223447429 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
922215494 1:223516474-223516496 GGAGGTAGGGAGGGTGTCCCTGG - Intergenic
922420869 1:225460446-225460468 GGCTGCAGGGAGGATGGCCCCGG - Intergenic
923875516 1:238042831-238042853 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
924242091 1:242051150-242051172 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
924639169 1:245816950-245816972 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1062851516 10:746370-746392 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1063796684 10:9520291-9520313 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1064840575 10:19586814-19586836 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1065080969 10:22129500-22129522 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1065107847 10:22408724-22408746 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1065230688 10:23595497-23595519 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1065397292 10:25252902-25252924 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1066033069 10:31449001-31449023 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1066146016 10:32559095-32559117 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1066441655 10:35445256-35445278 GGCGGCAGCATGGCTCTACCTGG - Intronic
1066934022 10:41803466-41803488 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1066982913 10:42435798-42435820 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1067333385 10:45341898-45341920 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1068050819 10:51947176-51947198 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1068074240 10:52233717-52233739 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1068309171 10:55256657-55256679 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1068333478 10:55602291-55602313 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1068339995 10:55688655-55688677 GGCGGCAGCGAGGCTGGGGAGGG - Intergenic
1068355094 10:55900057-55900079 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1068940666 10:62677927-62677949 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1069066809 10:63950353-63950375 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1069084242 10:64120700-64120722 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1069325894 10:67231078-67231100 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1069690413 10:70348156-70348178 GGTGGCAGCCAGGCTGTTCTGGG - Intronic
1070202138 10:74217297-74217319 GGCGGCAGCGAGGCTGGGAGAGG + Intronic
1070631607 10:78088866-78088888 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1070990490 10:80728110-80728132 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1071077551 10:81772802-81772824 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1071303903 10:84280384-84280406 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1071352648 10:84762446-84762468 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1071386475 10:85126157-85126179 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1072029375 10:91503680-91503702 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1072055379 10:91750033-91750055 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1072190684 10:93074242-93074264 GGCGGGAGCGCGGCGCTCCCCGG + Intronic
1072311985 10:94165338-94165360 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1073509215 10:104032877-104032899 GGTGGCAGAGAGCCAGTCCCTGG - Intronic
1073565683 10:104533939-104533961 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1073782138 10:106850174-106850196 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1073837727 10:107463962-107463984 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1074042175 10:109801118-109801140 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1074044654 10:109826242-109826264 GGTGGCAGCGAGGCTGTGGGAGG + Intergenic
1074257186 10:111814223-111814245 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1074282173 10:112062808-112062830 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1074286695 10:112104342-112104364 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1074465703 10:113679618-113679640 CGCGGCGGCTCGGCTGTCCCGGG + Intronic
1074616904 10:115078819-115078841 GGCAGCAGCGAGGCTGGGGCAGG - Intergenic
1074655916 10:115587347-115587369 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1074809092 10:117084625-117084647 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1074903276 10:117838475-117838497 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1075254213 10:120911376-120911398 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1075890505 10:125945654-125945676 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1075996665 10:126882283-126882305 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1076166583 10:128286976-128286998 GGCGGCAGGGAGGGCGCCCCTGG - Intergenic
1076619097 10:131775639-131775661 AGCGGCAGAGAGGCAGGCCCCGG + Intergenic
1076737727 10:132466211-132466233 GGCTGCAGTCAGGCTGGCCCTGG + Intergenic
1076969333 11:124478-124500 GGCGGCAGCAGGGCTGCCCACGG - Intergenic
1077435292 11:2536018-2536040 GGCTGGACCAAGGCTGTCCCGGG - Intronic
1077653927 11:4000012-4000034 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1077673223 11:4175834-4175856 GGCGGCAGCGAGGCTGGGGGCGG - Intergenic
1077857553 11:6144063-6144085 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1077861562 11:6185763-6185785 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1077886272 11:6390335-6390357 GGCGGAATCGGGGCGGTCCCGGG + Intergenic
1077946435 11:6905006-6905028 GGCGGCAGCGAGGCTGCAGGAGG + Intergenic
1078304813 11:10173564-10173586 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1078660171 11:13279044-13279066 GGCGGCAGCGGGTCTCTCACCGG - Intronic
1078807046 11:14716323-14716345 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1079286225 11:19135477-19135499 GGCGGCAGCGAGGCTGGGGAGGG + Intronic
1079577514 11:22021583-22021605 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1079618860 11:22528777-22528799 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1079660721 11:23033706-23033728 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1079681542 11:23303755-23303777 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1079760867 11:24328366-24328388 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1079842808 11:25425549-25425571 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1079873760 11:25831707-25831729 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1079964606 11:26965531-26965553 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1079988237 11:27220118-27220140 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1080234844 11:30056795-30056817 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1080705896 11:34692403-34692425 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1081087668 11:38821971-38821993 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1081231544 11:40591066-40591088 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1081468919 11:43351680-43351702 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1081488361 11:43548254-43548276 GGCGGCCGCGTCCCTGTCCCAGG + Intergenic
1082117835 11:48346397-48346419 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1082134660 11:48533635-48533657 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1082227492 11:49725699-49725721 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1082623910 11:55460331-55460353 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1082642860 11:55686057-55686079 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1082714178 11:56592251-56592273 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1082966092 11:58967392-58967414 GGCGGCTAAGAGTCTGTCCCAGG - Intronic
1085222063 11:74883099-74883121 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1085343439 11:75749030-75749052 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1085368850 11:75979585-75979607 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1086516913 11:87623734-87623756 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1086548542 11:88027650-88027672 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1086565736 11:88223912-88223934 GGCGGCAGCGAGGCTGGGAGAGG - Intergenic
1086730272 11:90240483-90240505 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1086979502 11:93178081-93178103 GGCGGCAGCGAGGCTGGTGGAGG - Intronic
1087067105 11:94037272-94037294 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1087087845 11:94238099-94238121 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1087228589 11:95631912-95631934 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1087687455 11:101281043-101281065 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1087860007 11:103141921-103141943 GGTGGCAGCGAGGCTGTGGGAGG - Intronic
1088292969 11:108261041-108261063 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1088302484 11:108373953-108373975 GGCTGCAGCGAGGCTGGCGGAGG + Intronic
1088370523 11:109083783-109083805 GGCGGCAGCGAGGCTGGTGGAGG - Intergenic
1088473275 11:110209392-110209414 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1088844928 11:113657025-113657047 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1088890239 11:114038273-114038295 GGCGGTAGCCAGGCGGGCCCAGG - Intergenic
1088957636 11:114626079-114626101 GGCGGCAGCGAGGCTGGGAGAGG + Intergenic
1089175401 11:116545304-116545326 GGCGGCAGAGATGATGTCTCAGG + Intergenic
1090509889 11:127363579-127363601 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1090547556 11:127782282-127782304 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1090706718 11:129344503-129344525 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1091434077 12:460074-460096 GGCGGCAGCGAGCCTGCGACGGG + Intergenic
1091550285 12:1530971-1530993 GGCGGCGGCGGGGCCGTCCCCGG - Intronic
1091627716 12:2135895-2135917 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1091797299 12:3304585-3304607 AGCGGCTGGGAGGCTGTCTCTGG + Intergenic
1091810974 12:3397799-3397821 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1091916520 12:4274445-4274467 GGGAGAAGCGAGGCTGTCCTGGG + Intronic
1091943189 12:4509301-4509323 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1092012022 12:5122004-5122026 GGCGGCAGCGAGGCTGCGGGAGG - Intergenic
1092031550 12:5290531-5290553 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1092553272 12:9527137-9527159 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1092707246 12:11298072-11298094 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1093615243 12:21214651-21214673 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1094092820 12:26669976-26669998 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1094162368 12:27405031-27405053 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1094282947 12:28760644-28760666 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1094494641 12:30981835-30981857 GGCTGCTGTGAGGCTGTCGCTGG - Intronic
1094518834 12:31163489-31163511 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1094810566 12:34133754-34133776 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1094861340 12:34469754-34469776 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1095059556 12:37666306-37666328 GGCGGCAGCGAGGCTGTGGGAGG - Intergenic
1095209401 12:39475366-39475388 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1095553361 12:43471389-43471411 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1095591302 12:43906899-43906921 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1095678925 12:44951376-44951398 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1095854826 12:46848987-46849009 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1095911130 12:47427320-47427342 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1096044892 12:48553910-48553932 GGCGGCAGCGAGGCTGAGGGAGG - Intergenic
1096895559 12:54818282-54818304 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1097252781 12:57646884-57646906 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1097305008 12:58059258-58059280 GGCGGCAGCGAGACTGGCGGAGG - Intergenic
1097310612 12:58114872-58114894 GGCAGCAGCGAGGCTGGCGGAGG - Intergenic
1097409081 12:59228037-59228059 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1097452335 12:59751531-59751553 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1097578179 12:61420686-61420708 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1097621227 12:61941856-61941878 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1097828208 12:64196004-64196026 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1097838013 12:64292940-64292962 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1098035980 12:66302483-66302505 GGCGGCCGCCAGGCCGTTCCCGG + Intergenic
1098387994 12:69939095-69939117 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1098395596 12:70013468-70013490 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1098624006 12:72640092-72640114 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1098726752 12:73978282-73978304 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1098923023 12:76320042-76320064 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1099001073 12:77178986-77179008 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1099040981 12:77654382-77654404 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1099242020 12:80149656-80149678 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1099250668 12:80249753-80249775 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1099750264 12:86764291-86764313 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1099881004 12:88466946-88466968 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1100624433 12:96316359-96316381 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1100907785 12:99321413-99321435 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1101077543 12:101146460-101146482 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1101189164 12:102313330-102313352 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1101297057 12:103434804-103434826 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1101401756 12:104394266-104394288 GGCGTCAGCGAGGCTGGGGCAGG - Intergenic
1101495088 12:105246218-105246240 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1101537136 12:105628678-105628700 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1101552609 12:105776483-105776505 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1101622060 12:106398265-106398287 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1101629270 12:106477452-106477474 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1101929057 12:108997364-108997386 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1102400159 12:112621611-112621633 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1103203609 12:119110534-119110556 GGCGGCAGCGAGGCTGGGGCAGG - Intronic
1103563548 12:121804482-121804504 GGCGGCAGCGAGGGGCTCCCGGG - Intronic
1104036809 12:125103279-125103301 GGCGGAAGAGAGACAGTCCCAGG + Intronic
1104251621 12:127100193-127100215 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1104639982 12:130461179-130461201 GGCTGCAGAGAGCCTGGCCCAGG + Intronic
1104718960 12:131034041-131034063 GGCGGCTGGGAGGCTGGCGCTGG - Intronic
1104763304 12:131311274-131311296 GGGGACTGCGTGGCTGTCCCAGG - Intergenic
1104811361 12:131622105-131622127 GGCTGCAGCTGGGCTGTCCTGGG + Intergenic
1104816194 12:131646796-131646818 GGGGACTGCGTGGCTGTCCCAGG + Intergenic
1104928119 12:132324288-132324310 GGCGGCAGCCAGGCATTGCCCGG + Intronic
1105338512 13:19497203-19497225 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1105577823 13:21669953-21669975 GGGCGCAGGCAGGCTGTCCCGGG + Intergenic
1105667361 13:22575150-22575172 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1105906135 13:24812230-24812252 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1106019173 13:25898738-25898760 GGCGGCAGCGAGGCTGGTGGAGG - Intronic
1106246502 13:27954411-27954433 GGCGGCGGAGAGGCGCTCCCCGG + Intergenic
1106617265 13:31341005-31341027 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1107154972 13:37155546-37155568 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1107227219 13:38065791-38065813 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1107639309 13:42425297-42425319 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1107788218 13:43975776-43975798 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1107971324 13:45645447-45645469 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1108174900 13:47782304-47782326 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1108241174 13:48465961-48465983 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1108414707 13:50185892-50185914 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1108502401 13:51080409-51080431 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1108657740 13:52551717-52551739 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1108837737 13:54572656-54572678 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1109138023 13:58678211-58678233 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1109754275 13:66737899-66737921 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1109823324 13:67685853-67685875 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1110586487 13:77199445-77199467 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1110812151 13:79822780-79822802 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1110841808 13:80152318-80152340 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1111004377 13:82229428-82229450 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1111917130 13:94372617-94372639 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1112061032 13:95740399-95740421 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1112113839 13:96331769-96331791 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1113107130 13:106783964-106783986 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1113488108 13:110669991-110670013 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1113850141 13:113413282-113413304 GGAGGCAGCGAGGCTGTTCCAGG - Intergenic
1113868197 13:113542980-113543002 GGCAGCCGAGAGGCTCTCCCGGG - Intronic
1114007947 14:18333677-18333699 GGCGGCAGAGAGCCTCTCCATGG - Intergenic
1114167603 14:20235870-20235892 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1114869182 14:26634861-26634883 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1115158219 14:30363953-30363975 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1115168303 14:30474457-30474479 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1115186178 14:30690399-30690421 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1115512389 14:34150490-34150512 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1115719837 14:36148251-36148273 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1115832347 14:37356495-37356517 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1115868267 14:37772392-37772414 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
1115968751 14:38922092-38922114 GGAGGCAGCGAGGCTGGGCGAGG + Intergenic
1116032486 14:39589855-39589877 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1116092420 14:40326621-40326643 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1116094290 14:40348476-40348498 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1116138149 14:40954497-40954519 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1116198326 14:41757465-41757487 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1116292607 14:43062751-43062773 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1116524552 14:45888819-45888841 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1116546069 14:46166843-46166865 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1116705038 14:48285414-48285436 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1116773100 14:49149702-49149724 GGCGGCAGCGAGGCTGGGAGAGG - Intergenic
1117280333 14:54234296-54234318 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1117349892 14:54870781-54870803 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1117452143 14:55862041-55862063 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1117468609 14:56019605-56019627 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1117531952 14:56667944-56667966 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1117849432 14:59952088-59952110 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1117936602 14:60914033-60914055 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1118095836 14:62536246-62536268 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1119097624 14:71848558-71848580 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1119139708 14:72255209-72255231 TGGGGCATAGAGGCTGTCCCCGG + Intronic
1120157941 14:81114583-81114605 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1120273856 14:82347966-82347988 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1120675725 14:87419273-87419295 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1120709766 14:87781160-87781182 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1120971533 14:90212368-90212390 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1121376769 14:93418735-93418757 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1121695763 14:95910667-95910689 GACGGCAGCCAGGCCATCCCTGG - Intergenic
1122068873 14:99192536-99192558 GGAGGCAGCGGGGCTGGGCCTGG - Intronic
1122270367 14:100566244-100566266 GGCGTCAGCGTTGCTGTCCCAGG - Intronic
1122419014 14:101563876-101563898 GTCGGGAGCCAGGCTGTACCGGG - Intergenic
1122517619 14:102319793-102319815 GGCGGCAGCGAGGATGGCGGCGG + Exonic
1122588091 14:102825253-102825275 GGTGGCAGCGAGGCTTTAACAGG - Intronic
1122829879 14:104390704-104390726 GGAGGGAGCGAGGCTGTCCCCGG + Intergenic
1122967357 14:105137647-105137669 GGCGGCAGCTAGGCGGCACCGGG - Intergenic
1122997755 14:105274747-105274769 GGGGGCAGTGAGGTTGGCCCAGG - Intronic
1124500344 15:30223022-30223044 GGCGGCGGCGGGGCTCTCCCCGG - Intergenic
1124502926 15:30245959-30245981 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1124740633 15:32292690-32292712 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1124743229 15:32315644-32315666 GGCGGCGGCGGGGCTCTCCCCGG + Intergenic
1125937682 15:43650374-43650396 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1126057002 15:44739657-44739679 GGCGGCAGCGAGGCTGTGGGAGG + Intronic
1126211436 15:46104950-46104972 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1126505146 15:49396400-49396422 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1126661419 15:51037214-51037236 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1127527065 15:59803772-59803794 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1127740221 15:61896655-61896677 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1128416765 15:67453938-67453960 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1129837494 15:78720248-78720270 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1129940376 15:79491377-79491399 GGCGGCAGCGAGGCTGGGAGAGG - Intergenic
1130187402 15:81697579-81697601 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1130197930 15:81798347-81798369 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1130205470 15:81871084-81871106 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1130218395 15:81995583-81995605 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1130382639 15:83384065-83384087 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1130618320 15:85434374-85434396 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1130798410 15:87235457-87235479 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1130818273 15:87464145-87464167 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1131014789 15:89049477-89049499 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1131331227 15:91501036-91501058 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1131510115 15:93045060-93045082 GGCGGCTGCGGGGCTGCCCCTGG - Exonic
1131584207 15:93675816-93675838 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1131916442 15:97271165-97271187 GGCGGCAGCGAGGCTGGCAGAGG - Intergenic
1131918402 15:97295882-97295904 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1131990954 15:98091951-98091973 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1132416892 15:101626865-101626887 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1132671373 16:1103451-1103473 GGCAGCTCCGAGCCTGTCCCGGG + Intergenic
1133225825 16:4339947-4339969 GTCGGCAGCCACCCTGTCCCTGG - Intronic
1133332020 16:4980760-4980782 GGGGGAAGGGAGGGTGTCCCGGG + Intronic
1133464794 16:6019314-6019336 GGCGGCAGCGCGGCTCGCACGGG - Intronic
1134043248 16:11083802-11083824 GGAGGCAGGGAGGCTGGCCCAGG + Intronic
1134184722 16:12075879-12075901 GGCGGCAGCGAGGCTGGTGGAGG - Intronic
1136917364 16:34218435-34218457 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1137081936 16:36072338-36072360 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1137304280 16:47183183-47183205 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1137472465 16:48774166-48774188 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1138583671 16:57957245-57957267 GTGGGCAGGGGGGCTGTCCCTGG - Intronic
1138712273 16:58983093-58983115 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1138842174 16:60523168-60523190 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1138941950 16:61801869-61801891 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1138951537 16:61918719-61918741 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1139215921 16:65123645-65123667 GGTGCCGGCGAGGCTGCCCCGGG + Intronic
1139530475 16:67540156-67540178 GGCCTCTGCCAGGCTGTCCCGGG - Exonic
1140583162 16:76255016-76255038 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1141228256 16:82139660-82139682 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1141649526 16:85385613-85385635 GTCAGCAGCCAGGCTGGCCCTGG - Intergenic
1142134356 16:88444798-88444820 GGCCTCAGCGTGGCTGTCCTGGG - Intergenic
1142362325 16:89633293-89633315 TGCGTCAGCGAGGTTGTCCCTGG - Intronic
1142451340 16:90174644-90174666 GGCGGCAGCAGGGCTGCCCACGG + Intergenic
1142936022 17:3332299-3332321 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1143255314 17:5553399-5553421 GGAGGCAGCGAGGGCGTCTCAGG + Exonic
1143527216 17:7479585-7479607 GGCGGCAGCGGGGCCGGGCCGGG - Intronic
1144092050 17:11866733-11866755 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1144205090 17:12974238-12974260 GGGGGCCGCGGGGCTGTCCAGGG - Exonic
1144781251 17:17809695-17809717 AGCTGCAGGGAGGCCGTCCCAGG - Intronic
1145718373 17:27045213-27045235 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1145724423 17:27104738-27104760 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1146440257 17:32887551-32887573 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1146752513 17:35394355-35394377 GGCGGCAGTGAGGCTGTGGGAGG + Intergenic
1147524328 17:41206463-41206485 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1147571215 17:41572174-41572196 GGAGGCAGCCGGGCTGCCCCAGG + Intergenic
1148240062 17:45994404-45994426 GGAGGCAGAGAGGCTGAGCCTGG + Intronic
1148407007 17:47424197-47424219 GGCGGCAGCCAGGCTGTGCAGGG + Intronic
1148755785 17:49972312-49972334 GGCGGCAGGGAAGGTGACCCGGG - Intronic
1148876555 17:50690680-50690702 AGCTGCAGCGAGGCTGACACTGG - Intronic
1148887619 17:50785278-50785300 GGTGGCAGCAAGGATGTCCTTGG - Intergenic
1149323087 17:55502127-55502149 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1149659995 17:58329274-58329296 GGGGGCAACCTGGCTGTCCCAGG + Intergenic
1149914889 17:60600036-60600058 GGAGGCAGCGCGGCCGTCGCAGG + Intergenic
1149942661 17:60887033-60887055 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1149961099 17:61110646-61110668 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1150818353 17:68413702-68413724 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1150879223 17:69004700-69004722 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1151880203 17:76890082-76890104 GGTGGCAGTGAGTCTGGCCCAGG - Intronic
1151969781 17:77451629-77451651 GCCGGGAGCCACGCTGTCCCTGG + Intronic
1152343369 17:79737504-79737526 GGAGGGAGCGAGGGTGGCCCAGG + Intronic
1152565270 17:81097528-81097550 GGCGGCCGCGAGGCTGAGTCAGG + Intronic
1152625685 17:81387011-81387033 GGAGGCAGCGGGGCGCTCCCCGG + Intergenic
1152743558 17:82029158-82029180 GGAGGCGGCGCGGCTGTCCCTGG + Exonic
1152763514 17:82122279-82122301 GGCCCCAGGGAGGCTGTCCCTGG - Intronic
1152802414 17:82337078-82337100 GGAGGCTGCGAGTCTGTCCACGG - Intergenic
1152814484 17:82399351-82399373 GTGGGCAGCGAGGCTGGCACCGG - Intronic
1203160540 17_GL000205v2_random:44993-45015 GGCGGCAGCGAGGCTGGGAGAGG + Intergenic
1153058964 18:976446-976468 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1153090353 18:1335608-1335630 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1153164612 18:2247584-2247606 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1153384586 18:4477743-4477765 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1153429900 18:5004553-5004575 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1153480573 18:5543349-5543371 GGCGGCAGCGGGCTCGTCCCGGG - Intronic
1153727006 18:7966859-7966881 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1153735525 18:8063046-8063068 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1153738578 18:8098968-8098990 GGTGGAAGGGAGGCTGCCCCAGG - Intronic
1154181151 18:12141062-12141084 GGCGGCAGCGAGGCTGGCGGAGG - Intergenic
1154188489 18:12208021-12208043 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1155093113 18:22530054-22530076 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1155617939 18:27743314-27743336 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1155986223 18:32233507-32233529 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1156044474 18:32862246-32862268 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1156176990 18:34557957-34557979 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1156236071 18:35206196-35206218 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1156344117 18:36240722-36240744 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1156730986 18:40193221-40193243 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1157039743 18:44024387-44024409 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1157205516 18:45694887-45694909 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1157397317 18:47353816-47353838 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1157517685 18:48322262-48322284 AGAGGAAGGGAGGCTGTCCCAGG + Intronic
1157923772 18:51741046-51741068 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1158074411 18:53511869-53511891 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1158114472 18:53979407-53979429 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1158271462 18:55721090-55721112 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1158286815 18:55893000-55893022 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1158637822 18:59177030-59177052 AGGGGCAGGGAGGCTTTCCCTGG + Intergenic
1158725724 18:59969751-59969773 GGCGGCAGCCAGGCTGTGCAGGG + Intergenic
1158732091 18:60035269-60035291 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1159466530 18:68790418-68790440 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1160093352 18:75847268-75847290 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1160224184 18:76999298-76999320 GGAGGTTGCGAGGCTGGCCCAGG - Intronic
1160274807 18:77421565-77421587 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1160631184 18:80247357-80247379 GGCGACGGCGAGGCTGACCGGGG - Exonic
1160646138 19:194404-194426 GGCGGCAGCAGGGCTGCCCACGG - Intergenic
1160864440 19:1250720-1250742 GGCGGCTGCGAGGGCGTCCCGGG + Intronic
1160944367 19:1634394-1634416 CGAGGCAGCCAGGCTGGCCCAGG - Intronic
1160966358 19:1748588-1748610 GGCTGCAGCGGGGCTGCCCTCGG - Intergenic
1160991075 19:1860573-1860595 GGTGGCTGCAGGGCTGTCCCGGG - Intronic
1162445292 19:10718868-10718890 GGTGGCAGGGAGGCTTGCCCAGG - Intronic
1162798431 19:13098314-13098336 GGCCGAAGCGGGGCTGGCCCAGG - Intronic
1162931336 19:13959369-13959391 CGAGGCAGGGGGGCTGTCCCGGG - Exonic
1163115189 19:15184944-15184966 GGCCGCTGCGAGTCTGCCCCTGG - Exonic
1163118329 19:15200960-15200982 GGCGGCGCGGAGGCTGGCCCGGG - Exonic
1163453791 19:17394219-17394241 GGCGGAACCGTGGGTGTCCCTGG - Intergenic
1163458010 19:17420148-17420170 AGCGGCGCCGAGTCTGTCCCGGG - Exonic
1163637715 19:18445136-18445158 GCGGGCAGGGAGGCTGCCCCGGG + Intronic
1163955390 19:20633499-20633521 GGCAGCAGCGAGGCTGGGCGAGG - Intronic
1164145663 19:22511044-22511066 GGAGGCAGTGAGGCTGTGTCAGG - Intronic
1164978395 19:32593190-32593212 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1165011017 19:32846450-32846472 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1165092197 19:33393212-33393234 GGCGTCGGGGAGGCCGTCCCGGG + Intronic
1165104472 19:33460854-33460876 GGCGGCAGCAAGGCCAACCCAGG + Intronic
1165153462 19:33773942-33773964 GCAGGAAGCAAGGCTGTCCCTGG + Intergenic
1165288165 19:34860605-34860627 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1165687902 19:37837918-37837940 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1166489620 19:43247666-43247688 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1166578363 19:43866873-43866895 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1167056143 19:47112550-47112572 GGCGGCGGCGGGGGGGTCCCGGG + Exonic
1167350206 19:48969571-48969593 GGTGGCACCGAGGCTGGCCGTGG + Exonic
925049382 2:799960-799982 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
925117032 2:1388418-1388440 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
925512514 2:4643385-4643407 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
926093624 2:10066191-10066213 GGAGGCAGCAAGTCTGGCCCTGG - Intronic
926568770 2:14507171-14507193 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
926595859 2:14789045-14789067 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
926601301 2:14848480-14848502 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
927034917 2:19164325-19164347 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
927142206 2:20138102-20138124 GGCTGCAGCGTGGCCCTCCCTGG - Intergenic
927426249 2:22984568-22984590 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
927448915 2:23189558-23189580 GGCTGGAGAGAGGCTGTCTCGGG - Intergenic
927453586 2:23230445-23230467 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
928309038 2:30194598-30194620 TGCGTCAGGGAAGCTGTCCCCGG - Intergenic
929082812 2:38138166-38138188 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
929295141 2:40238193-40238215 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
929952006 2:46418886-46418908 GGCGGCAGCGAGGCTAGGCGAGG + Intergenic
930467646 2:51774783-51774805 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
930521597 2:52474395-52474417 GCAGGCTGTGAGGCTGTCCCAGG - Intergenic
930615315 2:53587439-53587461 GGCGGCAGCGAGGCTGGGCGAGG + Intronic
930798703 2:55420064-55420086 GGCGGCGGCGAGGCTAGCCCGGG - Intergenic
930800997 2:55442523-55442545 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
930830867 2:55741945-55741967 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
931205508 2:60141607-60141629 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
931451113 2:62368524-62368546 GGCGGCAGCCACAATGTCCCAGG - Intergenic
931748621 2:65312004-65312026 GGCGTCCGCAAGCCTGTCCCCGG + Exonic
932306358 2:70706368-70706390 GGCGGCGGCGAGGCAGCCTCGGG + Exonic
932955915 2:76350889-76350911 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
933062368 2:77754168-77754190 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
933550391 2:83768719-83768741 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
934038358 2:88107651-88107673 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
934534536 2:95121980-95122002 GGCGCCCGCGGGGCTGTCCGCGG - Exonic
936553993 2:113477106-113477128 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
936576051 2:113656563-113656585 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
936621436 2:114102015-114102037 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
936700351 2:115004771-115004793 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
936782854 2:116054530-116054552 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
936914239 2:117623668-117623690 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
936916949 2:117649599-117649621 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
936932475 2:117804203-117804225 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
936967603 2:118142581-118142603 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
937453023 2:122018266-122018288 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
937457082 2:122051808-122051830 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
937654741 2:124361897-124361919 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
937676683 2:124598732-124598754 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
937809472 2:126183626-126183648 GGCGGCAACGAGGCTGTGGGAGG - Intergenic
938148928 2:128864578-128864600 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
938205398 2:129416964-129416986 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
938263102 2:129909118-129909140 GGCTGCTGCGAGGCTCCCCCAGG - Intergenic
938528608 2:132161685-132161707 GGCGGCAGAGAGCCTCTCCATGG + Exonic
938567161 2:132529286-132529308 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
938659418 2:133470599-133470621 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
938788535 2:134656136-134656158 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
939031098 2:137076298-137076320 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
939051666 2:137315095-137315117 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
939157671 2:138544441-138544463 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
939485990 2:142811856-142811878 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
939545090 2:143542085-143542107 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
939554882 2:143661973-143661995 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
939777642 2:146406156-146406178 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
940253416 2:151704448-151704470 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
940401877 2:153257040-153257062 GGCGGCAGCGAGGCTGGCGGAGG - Intergenic
940441326 2:153719864-153719886 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
940609020 2:155966303-155966325 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
940632287 2:156254934-156254956 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
940729078 2:157368952-157368974 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
940741610 2:157515560-157515582 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
940820636 2:158351629-158351651 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
940827865 2:158433905-158433927 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
940992804 2:160114928-160114950 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
941056748 2:160797745-160797767 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
941061859 2:160856311-160856333 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
941437133 2:165486348-165486370 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
941458398 2:165737256-165737278 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
941611616 2:167668538-167668560 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
942000998 2:171646980-171647002 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
942056937 2:172192983-172193005 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
942071068 2:172315683-172315705 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
942197179 2:173532881-173532903 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
942285277 2:174410047-174410069 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
942400232 2:175594131-175594153 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
942410509 2:175704444-175704466 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
942416019 2:175760012-175760034 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
942520327 2:176796836-176796858 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
942615335 2:177785814-177785836 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
943457290 2:188123923-188123945 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
943639675 2:190344139-190344161 CCCGGCAGCGAGGCCGCCCCCGG + Intronic
944018499 2:195073105-195073127 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
944043160 2:195378807-195378829 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
944262531 2:197693123-197693145 GGCGGCAGCGAGGCTGGGGGAGG - Exonic
944266169 2:197729368-197729390 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
945343548 2:208686074-208686096 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
945379971 2:209128946-209128968 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
945429856 2:209751770-209751792 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
945870451 2:215220666-215220688 GGCGGCAGCAAGGCTGGCAGAGG + Intergenic
945873526 2:215253387-215253409 GGCGGCAGCGAGGCTGAGGGAGG + Intergenic
946468300 2:219932235-219932257 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
946675497 2:222155195-222155217 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
947145937 2:227065282-227065304 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
947259541 2:228204867-228204889 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
947524586 2:230870450-230870472 GGTGGCAGCGTGGCTGAGCCCGG + Intronic
947592937 2:231395592-231395614 GGCGGCGGCGGGGCGGGCCCTGG + Exonic
948001462 2:234571250-234571272 CGCTGCAGTGAGCCTGTCCCTGG + Intergenic
948039557 2:234888805-234888827 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
948235791 2:236389250-236389272 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
948419660 2:237849158-237849180 GGCGGCAGCGAGGCTGGGAAGGG - Intergenic
948578053 2:238966664-238966686 GGAGGCCGCGTGGCTTTCCCAGG + Intergenic
948612383 2:239178169-239178191 GGTGGCAGAGAGGCTCTCCCAGG - Intronic
948780715 2:240320097-240320119 GGCAGAGGCGAGGCTCTCCCAGG - Intergenic
948811775 2:240482075-240482097 GATGGCATGGAGGCTGTCCCGGG + Intronic
948820869 2:240544912-240544934 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1168735322 20:130381-130403 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1169041778 20:2501241-2501263 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1169143331 20:3238138-3238160 GGCGGCCGGGACGCGGTCCCAGG - Exonic
1169516416 20:6321407-6321429 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1169672149 20:8114480-8114502 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1169714537 20:8600688-8600710 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1170049755 20:12129268-12129290 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1171056945 20:21916443-21916465 GGCGGCAGCGAGGCTGGGAGAGG - Intergenic
1171243496 20:23589718-23589740 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1173770441 20:45651869-45651891 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1174408926 20:50321274-50321296 GGCGGTACCTAGGCTGTACCTGG + Intergenic
1174789060 20:53461129-53461151 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1174793773 20:53504265-53504287 GGCGGCAGTGAGGCTGGCGGAGG + Intergenic
1175944278 20:62551484-62551506 AGCGGCGGCGAGGCTGCCCCCGG + Intronic
1176088760 20:63309770-63309792 GGGGGCAGGGAGGGTGTCCAGGG - Exonic
1176279369 20:64291812-64291834 GGCGGCAGCAGGGCTGCCCACGG + Intergenic
1176546802 21:8205762-8205784 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1176554707 21:8249971-8249993 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1176565753 21:8388809-8388831 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1176573628 21:8432996-8433018 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1176757941 21:10740061-10740083 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1176853249 21:13937428-13937450 GGGGGCAGCGCGGCGGGCCCTGG - Intergenic
1177810361 21:25918784-25918806 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1178770474 21:35499353-35499375 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1179975638 21:44864322-44864344 GGTGCCAGCCAGGCTGGCCCAGG + Intronic
1179997467 21:44980607-44980629 GGAGCCAGCGAGGCTGGCCAGGG - Intergenic
1180432454 22:15264487-15264509 GGCGGCAGAGAGCCTCTCCATGG - Intergenic
1180515027 22:16132467-16132489 GGCGGCAGAGAGCCTCTCCATGG - Intergenic
1180565550 22:16660793-16660815 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1180895762 22:19331154-19331176 GGGGCCAGCAAGGCAGTCCCAGG - Exonic
1181353796 22:22282374-22282396 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1181571037 22:23767910-23767932 GGCGGCAGCGGTGCTGTCGCGGG + Exonic
1181595560 22:23912291-23912313 GTCGGAAGGGAGGCTGTCTCGGG - Intergenic
1182145639 22:27995195-27995217 GGCTGCATCGACGCTGCCCCCGG + Intronic
1182157019 22:28083944-28083966 GGCGGAAGCGAGGCTGTGGGAGG + Intronic
1182184956 22:28392430-28392452 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1182982173 22:34682963-34682985 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1183186614 22:36295114-36295136 TGCTGGAGCGAGGCTGTCCCTGG + Intronic
1183545766 22:38454299-38454321 GGGGGCAGGGAGGCTGACACTGG + Intronic
1183685691 22:39360152-39360174 GGCTGCAGCCAGGCTGGCCTGGG - Intronic
1184050347 22:41999242-41999264 GGTGGCAGCGTGGCTGCCCTTGG + Intronic
1184886750 22:47351236-47351258 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1185131888 22:49043944-49043966 GGCAGCAGAGGGGCTGCCCCAGG + Intergenic
1185159603 22:49215265-49215287 GGCTGCAGCGAGGCTGGCCCTGG + Intergenic
1185424361 22:50756889-50756911 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1203251677 22_KI270733v1_random:122047-122069 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1203259727 22_KI270733v1_random:167129-167151 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
949201709 3:1387965-1387987 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
949457393 3:4253665-4253687 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
949527271 3:4916951-4916973 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
949660456 3:6272599-6272621 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
949678964 3:6490495-6490517 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
949702010 3:6769726-6769748 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
949873953 3:8611929-8611951 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
949888800 3:8716493-8716515 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
950729772 3:14947548-14947570 CGCGGCGGCGAGGCTGGCGCTGG + Intergenic
950757396 3:15187082-15187104 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
951028987 3:17860956-17860978 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
951101515 3:18693860-18693882 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
951121698 3:18936083-18936105 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
951135767 3:19102910-19102932 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
951157791 3:19376187-19376209 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
951447707 3:22801793-22801815 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
951573980 3:24095053-24095075 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
951827208 3:26881778-26881800 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
951861983 3:27263525-27263547 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
951917912 3:27821546-27821568 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
951939252 3:28059659-28059681 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
952472600 3:33671870-33671892 GGCGGCAGCGAGGCTGGGAGAGG + Intronic
952514435 3:34090116-34090138 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
952514951 3:34094492-34094514 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
952852147 3:37738321-37738343 CACGGCAGTGAGGCTGTCCATGG + Intronic
953099301 3:39809599-39809621 GGCTGCGGCCAGGCTGGCCCTGG + Exonic
953130625 3:40134316-40134338 GGCGGCAGCGAGGCTGCGGGAGG + Intronic
953214757 3:40907997-40908019 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
953289509 3:41647909-41647931 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
953458856 3:43065187-43065209 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
953513368 3:43566239-43566261 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
954393341 3:50279046-50279068 GGAGGCAGCCAGGCCTTCCCTGG + Exonic
954497489 3:50978733-50978755 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
954518304 3:51199466-51199488 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
954576161 3:51677516-51677538 GGAGGCAGTGAGGCTGTGTCAGG + Intronic
954931372 3:54285362-54285384 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
955014141 3:55051693-55051715 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
955255274 3:57324998-57325020 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
955606498 3:60710700-60710722 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
955652543 3:61210514-61210536 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
955669767 3:61391521-61391543 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
955843488 3:63136685-63136707 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
955890554 3:63645586-63645608 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
955899155 3:63733727-63733749 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
956265686 3:67393449-67393471 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
956866482 3:73374175-73374197 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
957018526 3:75097576-75097598 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
957034235 3:75279038-75279060 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
957102951 3:75850703-75850725 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
957324506 3:78675595-78675617 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
957601237 3:82337916-82337938 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
957604146 3:82376007-82376029 GGCGGCAGCGAGGCTGGGAGAGG - Intergenic
958063108 3:88508683-88508705 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
958090443 3:88870250-88870272 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
958210565 3:90468586-90468608 GGCGGCAGCGAGGCTGGGGTAGG - Intergenic
958407511 3:93767356-93767378 GGCGGCAGCGAGGCTGGGGTGGG + Intergenic
958569439 3:95860806-95860828 GGTGGCAGCGAGGCTGGGGCAGG + Intergenic
958704829 3:97641843-97641865 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
959100904 3:102008621-102008643 GGCAGCAGCGAGGCTGGGGCAGG + Intergenic
959198866 3:103220862-103220884 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
959723062 3:109513940-109513962 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
959833192 3:110889229-110889251 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
959994406 3:112664727-112664749 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
960238968 3:115318031-115318053 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
960545910 3:118914659-118914681 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
960553918 3:119007052-119007074 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
960850426 3:122047503-122047525 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
961087556 3:124082100-124082122 GGAGGCAGTGTAGCTGTCCCTGG + Intronic
961642601 3:128374025-128374047 GGAGGCAGCGGGGCTGGTCCAGG - Intronic
962004220 3:131331892-131331914 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
962080813 3:132137282-132137304 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
962104485 3:132376824-132376846 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
962397612 3:135030812-135030834 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
962458287 3:135585135-135585157 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
962648075 3:137460545-137460567 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
962664394 3:137639297-137639319 GGTGGCAGCGAGGCTGGGGCAGG - Intergenic
962761387 3:138518115-138518137 GGCGGCAGCGAGGCTGTGGGAGG + Intronic
963050728 3:141141039-141141061 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
963119262 3:141762703-141762725 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
963514686 3:146293611-146293633 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
963514695 3:146293634-146293656 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
963678742 3:148347687-148347709 GGCGGCAGCGAGGCTGCGGGAGG + Intergenic
964126727 3:153241349-153241371 GGCGGCAGCGAGGCTGGTGGAGG - Intergenic
964149457 3:153506820-153506842 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
964286595 3:155125007-155125029 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
964318536 3:155469479-155469501 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
964552173 3:157897233-157897255 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
964588115 3:158329942-158329964 GGCGGCAGCGAGGCTGGTGGAGG - Intronic
964589244 3:158341812-158341834 GCCGGGAGGGAGGCTGTACCAGG + Intronic
964688445 3:159423485-159423507 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
964696273 3:159511176-159511198 GGCGGCAGCGAGGCTGGGCGAGG - Intronic
964743305 3:159989066-159989088 GGTGGCTGGGAGGCTGACCCAGG - Exonic
965646214 3:170884147-170884169 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
966082039 3:176016539-176016561 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
966115297 3:176453878-176453900 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
966147429 3:176827455-176827477 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
966204680 3:177394361-177394383 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
966232236 3:177664893-177664915 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
966662150 3:182426507-182426529 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
966866150 3:184260110-184260132 GGCCGCTGCGAGGCTGGGCCCGG + Exonic
966982705 3:185152955-185152977 GGCGGGAGCGCGGCGGTCCCAGG + Exonic
967238486 3:187412540-187412562 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
967287867 3:187890617-187890639 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
967397327 3:189022816-189022838 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
967565320 3:190965101-190965123 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
967664516 3:192154902-192154924 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
967714271 3:192744806-192744828 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
967737172 3:192965214-192965236 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
968230611 3:197002944-197002966 GGCCGCGGCCAGGCCGTCCCAGG - Exonic
968371543 3:198225122-198225144 GGCGGCAGCAGGGCTGCCCACGG + Intergenic
968541223 4:1169379-1169401 GGCAGCACCGAGGCTGGCACAGG + Intronic
968634377 4:1670417-1670439 GGCAGCAGCGGGGCTGTGCCTGG - Intronic
968829354 4:2924511-2924533 GGCTCCAGCAAGGCTGACCCCGG - Intronic
969127188 4:4959482-4959504 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
969181285 4:5444189-5444211 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
969188293 4:5496291-5496313 GGCGGCAGCGAGGCTGGTGGAGG - Intronic
969199822 4:5593998-5594020 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
969219707 4:5751826-5751848 GGAGGCAGTGAGGGTGTTCCAGG + Intronic
969586449 4:8096965-8096987 TCCTGCAGCGAGGCTGTTCCAGG - Intronic
969945645 4:10780983-10781005 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
969950294 4:10828895-10828917 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
969980446 4:11149213-11149235 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
970134152 4:12903843-12903865 GGCGGCAGCGAGGCTGGGAGAGG + Intergenic
970206939 4:13664818-13664840 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
970283251 4:14481166-14481188 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
970299374 4:14665887-14665909 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
970348210 4:15174421-15174443 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
970489467 4:16557490-16557512 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
971167219 4:24196575-24196597 TGCAGTAGCCAGGCTGTCCCTGG + Intergenic
971389142 4:26169787-26169809 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
971621321 4:28857221-28857243 GGCGGCAGTGAGGCTGGGCGAGG - Intergenic
972677662 4:41276128-41276150 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
973541529 4:51940671-51940693 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
973640782 4:52900849-52900871 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
973671138 4:53219345-53219367 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
973682993 4:53340393-53340415 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
973914488 4:55619568-55619590 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
973922979 4:55708071-55708093 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
973935484 4:55842155-55842177 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
973986913 4:56363156-56363178 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
974090233 4:57303099-57303121 GGTGGCAGCGAGGCTGGCAGAGG - Intergenic
974143582 4:57919233-57919255 GGCAGCAGCGAGGCTGGCGGAGG - Intergenic
974659275 4:64864734-64864756 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
975034596 4:69664425-69664447 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
975154804 4:71059418-71059440 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
975250199 4:72169486-72169508 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
975277645 4:72520554-72520576 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
975283808 4:72594130-72594152 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
975368002 4:73551048-73551070 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
975504978 4:75127223-75127245 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
976170886 4:82303255-82303277 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
976289039 4:83398324-83398346 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
977023946 4:91791618-91791640 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
977218836 4:94314847-94314869 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
977264800 4:94841350-94841372 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
977288639 4:95139622-95139644 GGCGGCAGCGAGGCTGAGGGAGG - Intronic
977292214 4:95176830-95176852 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
977391455 4:96414786-96414808 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
977699575 4:100006118-100006140 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
977881504 4:102210520-102210542 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
977975186 4:103255853-103255875 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
978089142 4:104692477-104692499 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
978096688 4:104787402-104787424 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
978209649 4:106120369-106120391 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
978216682 4:106213771-106213793 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
978274667 4:106935519-106935541 GGCGGCAGCGAGGCTGGGTGAGG + Intronic
978599245 4:110411010-110411032 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
978626687 4:110693251-110693273 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
978663181 4:111152765-111152787 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
978864786 4:113494728-113494750 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
978893047 4:113852560-113852582 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
979042132 4:115812092-115812114 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
979112816 4:116780621-116780643 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
979196153 4:117922403-117922425 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
979401650 4:120256341-120256363 GGCGGCAGCGAGGCTGGGAGAGG - Intergenic
979640150 4:123004021-123004043 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
979953843 4:126928672-126928694 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
980016462 4:127655811-127655833 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
980139276 4:128895970-128895992 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
980149060 4:129023967-129023989 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
980316635 4:131209615-131209637 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
980448831 4:132944824-132944846 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
981060000 4:140413760-140413782 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
981192747 4:141882939-141882961 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
981493817 4:145369757-145369779 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
981590053 4:146350435-146350457 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
982310862 4:153983784-153983806 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
982511662 4:156290177-156290199 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
982581168 4:157180478-157180500 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
983101603 4:163632650-163632672 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
983156134 4:164351165-164351187 GGCGGCAGCGAGGCTGGGGTAGG + Intronic
983173229 4:164559085-164559107 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
983292037 4:165819311-165819333 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
983349567 4:166570392-166570414 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
983495932 4:168442407-168442429 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
983495941 4:168442430-168442452 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
983598796 4:169500108-169500130 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
983687800 4:170431800-170431822 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
983716593 4:170788575-170788597 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
983798998 4:171903547-171903569 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
984063455 4:175020156-175020178 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
984572856 4:181414477-181414499 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
984857670 4:184208643-184208665 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
985307925 4:188563849-188563871 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
985357564 4:189137496-189137518 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
985438914 4:189964168-189964190 GGCGGCAGCGAGGCTGGGAGAGG + Intergenic
985542648 5:493978-494000 TGAGGGAGGGAGGCTGTCCCTGG + Intronic
985755268 5:1710232-1710254 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
986359830 5:6966692-6966714 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
986375903 5:7130861-7130883 GGCGGCAGCGAGGCTGGAAGAGG - Intergenic
986379646 5:7170967-7170989 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
986385661 5:7231010-7231032 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
986472460 5:8089797-8089819 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
986978237 5:13416914-13416936 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
987273301 5:16335826-16335848 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
987424240 5:17755319-17755341 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
987482089 5:18472234-18472256 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
987534048 5:19161752-19161774 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
987980965 5:25083247-25083269 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
988284333 5:29191677-29191699 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
988375406 5:30429069-30429091 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
988405957 5:30823562-30823584 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
988880264 5:35494589-35494611 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
988887462 5:35573810-35573832 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
989248573 5:39281447-39281469 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
989302194 5:39907713-39907735 GGCGGCAGCGAGGCTGGGGGTGG + Intergenic
989355756 5:40541722-40541744 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
989492963 5:42078700-42078722 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
989528758 5:42482590-42482612 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
989550936 5:42735142-42735164 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
989653409 5:43718368-43718390 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
989860647 5:46371785-46371807 GGCGGCAGCGAGGCTGCTGGAGG + Intergenic
989941489 5:50156567-50156589 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
990093843 5:52087782-52087804 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
990708577 5:58557845-58557867 GGCGGCAGCGAGGCTGTGGGAGG - Intronic
991052936 5:62291956-62291978 GGTGGCAGCGAGGCTGTGGGAGG + Intergenic
991097318 5:62752825-62752847 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
991102106 5:62804560-62804582 GGCGGCAGCGAGGCTGCGGGAGG - Intergenic
991304707 5:65164434-65164456 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
991549265 5:67818351-67818373 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
991916396 5:71610156-71610178 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
992235710 5:74706724-74706746 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
992324004 5:75642650-75642672 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
992328987 5:75696116-75696138 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
992606082 5:78457773-78457795 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
992620146 5:78584872-78584894 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
992650368 5:78853772-78853794 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
992742149 5:79784506-79784528 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
992928482 5:81616505-81616527 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
993006599 5:82434984-82435006 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
993051647 5:82932860-82932882 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
993116099 5:83722030-83722052 GGAGGGAGCGGGGCTGGCCCTGG + Intergenic
993259318 5:85638865-85638887 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
993261526 5:85663205-85663227 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
993612614 5:90073645-90073667 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
993624537 5:90208751-90208773 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
993663588 5:90668198-90668220 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
993676523 5:90822004-90822026 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
993685220 5:90929220-90929242 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
993758474 5:91762551-91762573 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
993790229 5:92199056-92199078 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
993798741 5:92302547-92302569 GGCGGCAGCAAGGCTGGCGGAGG - Intergenic
993867600 5:93213561-93213583 GGCGGCAGCGAGGCTGGGGAGGG + Intergenic
993871682 5:93261453-93261475 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
994094318 5:95835131-95835153 GGCGGCGGCGAGGCAGTCACTGG - Intergenic
994160895 5:96555658-96555680 GGCGGCAGCGAGGCTGACGGAGG + Intronic
994648753 5:102500755-102500777 GGCAGAAGCTAGGTTGTCCCTGG - Intergenic
994780244 5:104079946-104079968 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
996419093 5:123242197-123242219 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
996609742 5:125364597-125364619 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
996788602 5:127268521-127268543 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
996813327 5:127544593-127544615 GGCGGCAGCGAGGCTGCGGGAGG - Intronic
996830938 5:127739518-127739540 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
996832215 5:127752701-127752723 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
997265128 5:132490842-132490864 GGCGCCCGCGCGGCTGTCCGGGG - Intergenic
997461846 5:134058269-134058291 GTCAGCAGCCGGGCTGTCCCTGG + Intergenic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
997582819 5:135028110-135028132 GGGGCCAGCGAGGCTCTACCAGG + Exonic
998048536 5:139011051-139011073 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
998256582 5:140593310-140593332 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
999003262 5:147946700-147946722 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
999025833 5:148231017-148231039 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
999033492 5:148320394-148320416 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
999485309 5:151989324-151989346 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
999506928 5:152207717-152207739 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1000014745 5:157266657-157266679 GGCGGCTGCCAGGCGGGCCCAGG - Intronic
1000280127 5:159774821-159774843 GGAGGCATTCAGGCTGTCCCTGG + Intergenic
1000500013 5:162036514-162036536 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1000835193 5:166145273-166145295 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1001348825 5:170936003-170936025 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
1001542555 5:172549800-172549822 GCCGACAGCAAGGCTGACCCGGG - Intergenic
1001898081 5:175398186-175398208 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1001983355 5:176052175-176052197 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1002011101 5:176282144-176282166 GGCGGCAGCGAGGCTGCAGGAGG - Intronic
1002093548 5:176818047-176818069 GGCGGCCGCGCGGCGGTGCCCGG - Intronic
1002234112 5:177791877-177791899 GGCGGCAGCGAGGCTGGGCGAGG - Intronic
1002304778 5:178276680-178276702 GGCTGCAGCAAGACTGTCCGGGG + Intronic
1002730781 5:181330668-181330690 GGCGGCAGCAGGGCTGCCCACGG + Intergenic
1202775167 5_GL000208v1_random:63034-63056 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1202775402 5_GL000208v1_random:65694-65716 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1002904001 6:1434311-1434333 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1003413959 6:5891795-5891817 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1003446596 6:6190812-6190834 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1003649782 6:7948883-7948905 GGCAGCAGCGAGGCTGGCGGAGG - Intronic
1003726952 6:8776080-8776102 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1003813456 6:9811167-9811189 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1005239184 6:23804462-23804484 GGCAGCAGCGAGGCTGGGGCGGG + Intergenic
1005663137 6:28021176-28021198 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1006092435 6:31636021-31636043 GGGTGCAGTGAGGGTGTCCCAGG - Exonic
1006820083 6:36886069-36886091 GGGCGCGGCGAGGCTGTCACAGG - Intronic
1007789793 6:44302411-44302433 GGAGGCACTGAGGCTGTCCAAGG - Exonic
1007872995 6:45062864-45062886 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1007881831 6:45176478-45176500 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1008262756 6:49387297-49387319 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1008388482 6:50921541-50921563 GGCGGCAGCAAGGCTGTGGAGGG - Intergenic
1008470110 6:51875166-51875188 GGCGGCAACGAGGCTGTGGGAGG + Intronic
1008530009 6:52448280-52448302 GGCGGCAGCGAGGCTGGTGGAGG - Intronic
1008769497 6:54961839-54961861 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1008874123 6:56307431-56307453 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1008915780 6:56785424-56785446 GGCGGCAGCGAGGCTGGCGGAGG - Intronic
1009056520 6:58342461-58342483 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1009829549 6:68912989-68913011 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1009876787 6:69515555-69515577 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1009943616 6:70317981-70318003 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1010000537 6:70944498-70944520 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1010129048 6:72469849-72469871 GGCGGCAGCGAGGCTGGGAGAGG + Intergenic
1010263324 6:73840998-73841020 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1010523893 6:76876637-76876659 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1010540625 6:77088062-77088084 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1010695732 6:78971931-78971953 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1010834834 6:80573507-80573529 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1010957009 6:82101716-82101738 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1010998332 6:82558817-82558839 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1011107920 6:83803331-83803353 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1011303087 6:85896668-85896690 GGTGGCAGCGAGGCTGTGGGAGG - Intergenic
1011315538 6:86027076-86027098 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1011373983 6:86670800-86670822 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1011517227 6:88166892-88166914 GGCGGCAGCGAGCTGGGCCCGGG + Intergenic
1011619659 6:89230851-89230873 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1011711025 6:90054399-90054421 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1011999616 6:93637171-93637193 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1012085800 6:94824579-94824601 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012151373 6:95758802-95758824 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012338392 6:98088765-98088787 GGCGGCAGCGAGGCTGAGGGAGG - Intergenic
1012363965 6:98416915-98416937 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012387944 6:98703473-98703495 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012527613 6:100196877-100196899 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012540364 6:100355119-100355141 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012608615 6:101188554-101188576 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012680175 6:102170082-102170104 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1012722112 6:102758470-102758492 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1012791961 6:103709445-103709467 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1013422424 6:109978696-109978718 GGCAGCAGAGACGCTGTCCGCGG - Exonic
1013704211 6:112813438-112813460 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1013735887 6:113226903-113226925 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1013878608 6:114865706-114865728 GGCGGCAGCGAGGCTGGTGGAGG + Intergenic
1013898390 6:115121667-115121689 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1013902560 6:115175641-115175663 GGCGGCAGCGAGGCTGGGTGAGG + Intergenic
1014071069 6:117182232-117182254 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1014076820 6:117245168-117245190 GGCGGCAGCGAGGCTGCGGGAGG + Intergenic
1014120685 6:117721713-117721735 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1014277227 6:119400400-119400422 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1014953995 6:127593697-127593719 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1015056693 6:128911225-128911247 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1016296381 6:142577420-142577442 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1016365147 6:143307919-143307941 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1017399145 6:154039543-154039565 GGGGGCAGCGCTGCTGTCCATGG - Exonic
1017624086 6:156330572-156330594 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1018126220 6:160685312-160685334 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1018340253 6:162844186-162844208 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1018354220 6:162995329-162995351 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1018525757 6:164708465-164708487 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1020017111 7:4837476-4837498 GGAGGCAGCGATGCTGTTGCAGG - Intronic
1020275492 7:6622252-6622274 GGCGGCGGAGCGGCGGTCCCGGG + Exonic
1020449296 7:8303703-8303725 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1020454114 7:8352149-8352171 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1020536489 7:9404350-9404372 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1020538976 7:9436811-9436833 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1020640436 7:10747487-10747509 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1020645672 7:10811610-10811632 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1020779288 7:12497637-12497659 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1020845304 7:13274396-13274418 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1020884701 7:13806683-13806705 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1020924971 7:14313685-14313707 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1020948668 7:14648048-14648070 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1021016994 7:15547719-15547741 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1021359054 7:19689276-19689298 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1021618644 7:22528713-22528735 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1021671157 7:23036144-23036166 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1021701262 7:23321476-23321498 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1021753470 7:23828302-23828324 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1021875723 7:25047453-25047475 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1021933222 7:25603437-25603459 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1021992728 7:26152931-26152953 GGCGGCAGCCAGGCTGTGCAGGG + Exonic
1022187287 7:27982383-27982405 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1022352674 7:29580350-29580372 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1022439304 7:30420068-30420090 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1022464266 7:30642395-30642417 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1022775906 7:33527336-33527358 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1022820169 7:33951655-33951677 GGGGGCAGCCAGTCTGTACCAGG - Intronic
1022824379 7:33994208-33994230 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1022842168 7:34175153-34175175 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1022874434 7:34513873-34513895 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1022911899 7:34906655-34906677 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1022929239 7:35093372-35093394 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1023194318 7:37617637-37617659 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1023255794 7:38311318-38311340 GGCGGCAGCGGTTCTGTCGCGGG - Intergenic
1023322469 7:39013116-39013138 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1023717595 7:43059511-43059533 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1023755877 7:43416617-43416639 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1023889386 7:44381615-44381637 GGCAGCAGGGAGGCTGGCCAGGG + Exonic
1024044937 7:45579838-45579860 GGAAGCAGCGAGGCTGCCACAGG - Intronic
1024205864 7:47160095-47160117 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1024592345 7:50899259-50899281 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1024699371 7:51890324-51890346 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1024796909 7:53031906-53031928 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1025272702 7:57540000-57540022 GGCGGCAGCGAGGCTGTGGGAGG + Intergenic
1025687783 7:63732875-63732897 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1025967900 7:66292446-66292468 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1027216544 7:76187366-76187388 GGCGGGAGTGAGACTGTCTCAGG + Intergenic
1027523218 7:79235382-79235404 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1028062531 7:86340623-86340645 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1028395516 7:90364837-90364859 GGCGGCAGTGAGGCTGGCGGGGG - Intronic
1028467993 7:91173860-91173882 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1028489471 7:91395069-91395091 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1028507241 7:91583687-91583709 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1028537815 7:91909271-91909293 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1029059167 7:97779042-97779064 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
1029949016 7:104563270-104563292 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1030260973 7:107563862-107563884 GGCGGCAGCGTCGCTGTAGCTGG - Exonic
1030518146 7:110563125-110563147 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1030592606 7:111500238-111500260 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
1030708560 7:112721557-112721579 GGCAGGAGCGAGACTGTGCCAGG - Intergenic
1030753701 7:113263286-113263308 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1030795476 7:113781715-113781737 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1030893680 7:115030675-115030697 GGCGGCAGCGAGGCTGGGGTAGG - Intergenic
1031029972 7:116724071-116724093 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1031477317 7:122238938-122238960 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1031481609 7:122284507-122284529 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1031527062 7:122834718-122834740 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1031585437 7:123527903-123527925 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1031664563 7:124468439-124468461 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1031706358 7:124985051-124985073 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1031721453 7:125181541-125181563 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1032289705 7:130577901-130577923 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1032652584 7:133895017-133895039 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1032881881 7:136099258-136099280 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1032910170 7:136419775-136419797 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1032972537 7:137182026-137182048 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1033107088 7:138536923-138536945 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
1033504388 7:141985675-141985697 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1033830123 7:145241638-145241660 GGCAGCAGCGAGGCTGTGGGAGG - Intergenic
1033891592 7:146019155-146019177 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1033960371 7:146906205-146906227 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1034236937 7:149579508-149579530 GGCGGCAGCGAGGCTGGGGTAGG - Intergenic
1034446044 7:151114871-151114893 GGCGGCAGCGCGGCCGGCCGAGG - Intronic
1034723969 7:153318310-153318332 GGCAGCAGCGAGGCTGGCAGAGG - Intergenic
1034737868 7:153445875-153445897 GGCAGCACCGAGGCTGACCTTGG + Intergenic
1035697250 8:1607943-1607965 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1035745164 8:1956839-1956861 GCCAGGAGCCAGGCTGTCCCTGG - Exonic
1036407885 8:8471275-8471297 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1036689793 8:10937989-10938011 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1037146774 8:15581897-15581919 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1037232039 8:16670535-16670557 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1037255115 8:16944383-16944405 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1037465034 8:19151518-19151540 GGCAGCAGCTAGGCAGTTCCTGG - Intergenic
1037774762 8:21826133-21826155 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1038031993 8:23650781-23650803 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1038107672 8:24454366-24454388 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1038226211 8:25660512-25660534 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1038234207 8:25735930-25735952 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1038305340 8:26396027-26396049 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1038575401 8:28700502-28700524 GGCAGCTGCGAGCCTGTCTCTGG + Intronic
1039127065 8:34215351-34215373 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1039317964 8:36394170-36394192 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1039319593 8:36413828-36413850 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1040390131 8:46942577-46942599 GGCGGCAGCGAGGCTGAGGGAGG + Intergenic
1040445113 8:47485286-47485308 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1040992704 8:53369428-53369450 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1041035601 8:53786246-53786268 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1041301434 8:56415639-56415661 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1041387478 8:57319535-57319557 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1041736928 8:61120961-61120983 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1041771793 8:61480291-61480313 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1041817802 8:61994719-61994741 GGCGGCAGCGAGGCTGGACGAGG + Intergenic
1041845379 8:62322037-62322059 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1041999250 8:64102647-64102669 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1042010574 8:64240511-64240533 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1042040130 8:64581073-64581095 GGCGGCGGGGTGGGTGTCCCCGG + Exonic
1042270873 8:66954682-66954704 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1042476535 8:69254635-69254657 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1042486993 8:69356980-69357002 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1042534374 8:69843717-69843739 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1042682264 8:71399003-71399025 GGCAGCAGCAAGGCTGTCGGAGG - Intergenic
1042682958 8:71406777-71406799 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1042731452 8:71939554-71939576 GGCAGCAGCGAGGCTGTGGGAGG - Intronic
1042750486 8:72153028-72153050 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1042779928 8:72479851-72479873 GGCGGCAGCGAGGCTGAGGGAGG + Intergenic
1043009747 8:74866936-74866958 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043016719 8:74948240-74948262 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1043042361 8:75278784-75278806 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043045938 8:75324636-75324658 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043119785 8:76308524-76308546 GGCGGCAGCGAGGCTGGGGCAGG + Intergenic
1043181254 8:77088828-77088850 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043241538 8:77940927-77940949 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043555652 8:81427629-81427651 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043585808 8:81768627-81768649 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1043870291 8:85424552-85424574 GGTGGCAGCGAGGCTGTGGGAGG - Intronic
1044101700 8:88149264-88149286 GGCGGCAGCGAGGCTGGGTGAGG + Intronic
1044157028 8:88860345-88860367 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1044211663 8:89557927-89557949 GGCGGCAACGAGGCTGTGGGAGG - Intergenic
1044284836 8:90399092-90399114 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1044353857 8:91197431-91197453 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1044403006 8:91793969-91793991 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1044409810 8:91869929-91869951 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1044453909 8:92369770-92369792 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1044816350 8:96117087-96117109 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1044909817 8:97045200-97045222 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1044936266 8:97296016-97296038 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1045044435 8:98260682-98260704 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1045087257 8:98700078-98700100 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1045408505 8:101891916-101891938 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1045591992 8:103608579-103608601 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1045689408 8:104745435-104745457 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1045775244 8:105794794-105794816 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1045897980 8:107241024-107241046 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1045954955 8:107895468-107895490 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1046081577 8:109376209-109376231 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1046682904 8:117191855-117191877 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1046894835 8:119461920-119461942 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1047070153 8:121334379-121334401 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1047149523 8:122244835-122244857 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1047590136 8:126318650-126318672 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1047592514 8:126342000-126342022 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1047639714 8:126805208-126805230 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1047804405 8:128344059-128344081 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1047845571 8:128801651-128801673 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1047854700 8:128897084-128897106 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1048002318 8:130388891-130388913 GGCTGCAGGGAGTCTGGCCCTGG - Intronic
1048138672 8:131771318-131771340 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1048792505 8:138116580-138116602 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1048943788 8:139426187-139426209 GGAGGCAGTGAAGCTGTCTCTGG + Intergenic
1049201758 8:141343777-141343799 GGCAGCAGCGGGGCAGTCCTGGG + Intergenic
1049610851 8:143554056-143554078 AGAGGCAGCGAGGCTGTACAGGG + Intronic
1049654743 8:143792558-143792580 GGCCGAAGCGAGGCTCGCCCTGG - Exonic
1049796680 8:144500273-144500295 GGCGGCCTCGATGCTGTCCTGGG - Exonic
1050015047 9:1224287-1224309 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1050178990 9:2899791-2899813 GGCGGCAGCGAGGCTGAGGGAGG - Intergenic
1050337797 9:4606202-4606224 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1050486135 9:6136261-6136283 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1050509245 9:6376682-6376704 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1051060358 9:13038300-13038322 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1051223616 9:14876391-14876413 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1051778091 9:20658366-20658388 GGCGGCAGCGAGGCTGCGGGAGG - Exonic
1051886197 9:21895742-21895764 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1051896584 9:21994820-21994842 CGCGGGAGCGCGGCTGTTCCTGG - Intronic
1051928237 9:22354425-22354447 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1052083018 9:24230241-24230263 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1052239089 9:26250188-26250210 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1052429491 9:28348552-28348574 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1052513446 9:29450810-29450832 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1052650396 9:31294482-31294504 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1052701034 9:31937936-31937958 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1052773528 9:32710793-32710815 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1053707222 9:40768025-40768047 GGCGGCAGAGAGCCTCTCCATGG + Intergenic
1053742061 9:41150376-41150398 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1054301700 9:63385231-63385253 GGCGGCGGCGAGGCGGTCGGCGG - Intergenic
1054345803 9:63913797-63913819 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1054417135 9:64888793-64888815 GGCGGCAGAGAGCCTCTCCATGG + Intergenic
1054445054 9:65306520-65306542 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1054450417 9:65400926-65400948 GGCTCCAGGGAGGCTGTCTCTGG - Intergenic
1054485220 9:65714986-65715008 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1054686284 9:68280924-68280946 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1055346612 9:75346290-75346312 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1055721772 9:79182855-79182877 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1056049900 9:82757428-82757450 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1056051575 9:82774936-82774958 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1056209679 9:84354199-84354221 CTCCTCAGCGAGGCTGTCCCAGG + Intergenic
1056284804 9:85077250-85077272 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1056440012 9:86611624-86611646 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1056582537 9:87902552-87902574 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1056792159 9:89633016-89633038 CGCTTCAGCGAGGCTGTCCCTGG + Intergenic
1057163147 9:92905633-92905655 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1057322349 9:94026056-94026078 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1057638865 9:96797421-96797443 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1057728397 9:97586593-97586615 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1057800270 9:98186803-98186825 GGAGGAAGCCAGGCTGACCCTGG - Intronic
1057965514 9:99499157-99499179 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1058063885 9:100527644-100527666 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1058079987 9:100691131-100691153 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1058498063 9:105581755-105581777 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1058516616 9:105782644-105782666 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1058557671 9:106187205-106187227 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1058767338 9:108194621-108194643 GGAGGCAGGGAGGCTGTCAGAGG - Intergenic
1058796283 9:108501508-108501530 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1058962549 9:110005734-110005756 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1059191739 9:112333542-112333564 GGCGGCAGCAGGGCGGTTCCGGG + Intronic
1059732552 9:117071599-117071621 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1059743556 9:117178846-117178868 GGCTGCAGCCAGGGTGTTCCTGG + Intronic
1059967186 9:119626913-119626935 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1060012456 9:120055653-120055675 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1060324086 9:122595731-122595753 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1060465791 9:123903775-123903797 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1061207772 9:129174501-129174523 GGCGGACGCAAGCCTGTCCCCGG - Intergenic
1061798575 9:133102379-133102401 GGAGTCAGGGAGGCTGGCCCTGG - Intronic
1062380258 9:136283687-136283709 GGCTGCACCCAGGCTGTGCCAGG + Intronic
1062456890 9:136644260-136644282 GTCGGCAGCCAGGCTTTCCCTGG + Intergenic
1062615096 9:137392743-137392765 GGGGGCACCGAGGCTGTTCCAGG + Intronic
1062615103 9:137392764-137392786 GGGGGCACCGAGGCTGTTCCAGG + Intronic
1062615129 9:137392851-137392873 GGGGGCACCGAGGCTGTTCCAGG + Intronic
1062615164 9:137392978-137393000 GGGGGCACCGAGGCTGTTCTCGG + Intronic
1062615189 9:137393065-137393087 GGGGGCACCGAGGCTGTTCTCGG + Intronic
1062615208 9:137393131-137393153 GGGGGCGCCGAGGCTGTTCCAGG + Intronic
1062631724 9:137466109-137466131 GGGGGCCGTGGGGCTGTCCCTGG - Intronic
1062755189 9:138283175-138283197 GGCGGCAGCAGGGCTGCCCACGG + Intergenic
1203768389 EBV:38326-38348 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768439 EBV:38451-38473 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768489 EBV:38576-38598 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768539 EBV:38701-38723 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768589 EBV:38826-38848 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768639 EBV:38951-38973 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768689 EBV:39076-39098 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768739 EBV:39201-39223 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768789 EBV:39326-39348 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768839 EBV:39451-39473 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768889 EBV:39576-39598 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203768939 EBV:39701-39723 GGCGGCCGCCCGGCTGCCCCCGG - Intergenic
1203691238 Un_GL000214v1:45211-45233 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1203468079 Un_GL000220v1:105198-105220 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1203475900 Un_GL000220v1:149170-149192 GGCGGCCGGGAGGGCGTCCCCGG + Intergenic
1203579100 Un_KI270745v1:27347-27369 GGCGGCAGCAGGGCTGCCCACGG + Intergenic
1203645057 Un_KI270751v1:58980-59002 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1186041173 X:5480871-5480893 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1186243331 X:7593316-7593338 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1186992940 X:15088827-15088849 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1187223043 X:17348070-17348092 GGCGGCAGCGAGGCTGGGGGCGG - Intergenic
1187271777 X:17786950-17786972 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1187307014 X:18104707-18104729 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1187419573 X:19122617-19122639 GGCGGCGGCGAGGCTGGGCGCGG + Intronic
1187422000 X:19143085-19143107 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1187513663 X:19945862-19945884 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1187763131 X:22609601-22609623 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1187857497 X:23651405-23651427 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1188276456 X:28207183-28207205 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1188791953 X:34415565-34415587 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1188936004 X:36175888-36175910 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1189042854 X:37560925-37560947 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1189562713 X:42207745-42207767 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1189583297 X:42430454-42430476 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1189597969 X:42590076-42590098 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1189625119 X:42888766-42888788 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1189997846 X:46655775-46655797 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1190134395 X:47782236-47782258 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1190135138 X:47789261-47789283 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1190216511 X:48482532-48482554 GGTGGGAGGGAGGCTGTCCTAGG + Intronic
1190279290 X:48918776-48918798 GGCGGCGGCGTGGGGGTCCCGGG + Exonic
1190403247 X:50060560-50060582 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1190536443 X:51433160-51433182 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
1190556953 X:51645175-51645197 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1190615138 X:52222510-52222532 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1190807659 X:53854155-53854177 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1191020233 X:55851478-55851500 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
1191125861 X:56953383-56953405 GGCAGCAGCGAGGCTGGCGGAGG - Intergenic
1191145724 X:57163449-57163471 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1191565016 X:62517518-62517540 GGCGGCAGCGAGGCTGTGGGAGG + Intergenic
1191708101 X:64115593-64115615 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1191709797 X:64137471-64137493 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1191855265 X:65620296-65620318 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1191981504 X:66930437-66930459 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1191982650 X:66943208-66943230 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1192096477 X:68217332-68217354 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1192290431 X:69788880-69788902 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1192294035 X:69828288-69828310 GGCGGCAGCGAGGCTGGGAGAGG - Intronic
1192598922 X:72440962-72440984 GGCGGCAGCGAGGCTGAGGGAGG + Intronic
1192704149 X:73511462-73511484 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1192906838 X:75560740-75560762 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1192907472 X:75566864-75566886 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1192974410 X:76267822-76267844 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1192987433 X:76415249-76415271 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1193054685 X:77137696-77137718 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1193123429 X:77847141-77847163 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1193244378 X:79211404-79211426 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1193304002 X:79927215-79927237 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1193346041 X:80405657-80405679 GGCGGCAGCGAGGCTGGAGGAGG + Intronic
1193456989 X:81743582-81743604 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1193765998 X:85529624-85529646 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1193817241 X:86118909-86118931 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1194306503 X:92256022-92256044 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1194741891 X:97583762-97583784 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1194814918 X:98429919-98429941 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1194962884 X:100255898-100255920 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1195167634 X:102236186-102236208 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1195191223 X:102450901-102450923 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1195233699 X:102876887-102876909 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1195261038 X:103131814-103131836 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1195339978 X:103897099-103897121 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1195355139 X:104032465-104032487 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1195421232 X:104677685-104677707 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1195442088 X:104909941-104909963 GGCGTCAGCGAGGCTGGCGGAGG - Intronic
1195572027 X:106407442-106407464 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1196077540 X:111594289-111594311 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1196183314 X:112719026-112719048 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1196359554 X:114836294-114836316 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1196511775 X:116520198-116520220 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
1196546558 X:116970397-116970419 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1196626192 X:117879585-117879607 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1196638495 X:118032144-118032166 GGCGGCAGCGAGGCTGGGGGAGG + Intronic
1196863765 X:120052078-120052100 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1196879334 X:120184252-120184274 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197239691 X:124110095-124110117 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1197370004 X:125614531-125614553 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1197389139 X:125839273-125839295 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197410496 X:126109711-126109733 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1197491476 X:127122291-127122313 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1197824366 X:130573259-130573281 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1197877755 X:131128807-131128829 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1197889247 X:131251139-131251161 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1197902040 X:131383931-131383953 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1197909173 X:131462013-131462035 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197917608 X:131553104-131553126 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197919684 X:131579094-131579116 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197927713 X:131664369-131664391 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197972854 X:132133180-132133202 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1197975423 X:132161722-132161744 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1198819610 X:140633320-140633342 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1199484249 X:148331170-148331192 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1199587954 X:149436231-149436253 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1199884587 X:152007188-152007210 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1199933118 X:152544936-152544958 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1199996617 X:153030281-153030303 GACGCCAGCCAGGCTGACCCTGG + Intergenic
1200034570 X:153319275-153319297 GACGCCAGCGAGGCTGATCCCGG - Intergenic
1200215381 X:154365934-154365956 GGCTGCAGCGGGACTGGCCCAGG + Intronic
1200224765 X:154411460-154411482 GACGGCAGCGAGGCCAGCCCCGG - Intronic
1200537636 Y:4419066-4419088 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1200581403 Y:4954503-4954525 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1200589085 Y:5046700-5046722 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1200774661 Y:7159695-7159717 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1200785224 Y:7255137-7255159 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1201017591 Y:9622207-9622229 TGGGGCAGCGGGGCTGTCACAGG - Intergenic
1201359985 Y:13136085-13136107 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1201397500 Y:13564857-13564879 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1201441450 Y:14012944-14012966 GGCGGCAGCGAGGCTGGGGGAGG + Intergenic
1201443120 Y:14029763-14029785 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1201933394 Y:19378876-19378898 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1202066878 Y:20949720-20949742 GGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1202109136 Y:21403697-21403719 TGGGGCAGTGAGGCTGTCACGGG - Intergenic
1202120138 Y:21512422-21512444 TGGGGCAGTGAGGCTGTCACGGG + Intronic
1202122589 Y:21535963-21535985 TGGGGCAGTGAGGCTGTCACGGG + Intronic
1202156416 Y:21893420-21893442 TGGGGCAGTGAGGCTGTCACGGG - Intronic
1202158864 Y:21916961-21916983 TGGGGCAGTGAGGCTGTCACGGG - Intronic
1202185315 Y:22181876-22181898 TGGGGCAGTGAGGCTGTCACGGG - Intronic
1202197549 Y:22309909-22309931 TGGGGCAGTGAGGCTGTCACGGG + Intronic
1202200775 Y:22345206-22345228 GGCGGCAGCGAGGCTGGGGGAGG - Intronic
1202206045 Y:22404519-22404541 TGGGGCAGTGAGGCTGTCACGGG + Intronic