ID: 921207175

View in Genome Browser
Species Human (GRCh38)
Location 1:212858623-212858645
Sequence CGCTGCCGCCTCGGGAGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921207157_921207175 24 Left 921207157 1:212858576-212858598 CCCAAAGCGGGCACCTTCCCGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207169_921207175 -9 Left 921207169 1:212858609-212858631 CCCCGGGACAGCCTCGCTGCCGC 0: 1
1: 0
2: 1
3: 25
4: 142
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207166_921207175 6 Left 921207166 1:212858594-212858616 CCGGTGAATGGGGCCCCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207170_921207175 -10 Left 921207170 1:212858610-212858632 CCCGGGACAGCCTCGCTGCCGCC 0: 1
1: 0
2: 3
3: 51
4: 1378
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207158_921207175 23 Left 921207158 1:212858577-212858599 CCAAAGCGGGCACCTTCCCGGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207164_921207175 7 Left 921207164 1:212858593-212858615 CCCGGTGAATGGGGCCCCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207168_921207175 -8 Left 921207168 1:212858608-212858630 CCCCCGGGACAGCCTCGCTGCCG 0: 1
1: 0
2: 0
3: 16
4: 217
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207167_921207175 -7 Left 921207167 1:212858607-212858629 CCCCCCGGGACAGCCTCGCTGCC 0: 1
1: 0
2: 0
3: 22
4: 169
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78
921207162_921207175 11 Left 921207162 1:212858589-212858611 CCTTCCCGGTGAATGGGGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921207175 Original CRISPR CGCTGCCGCCTCGGGAGTTC TGG Exonic
900127364 1:1074468-1074490 CGCTGCAGCCTGGGCAGGTCTGG + Intergenic
900294022 1:1939612-1939634 CGCTCCTGCCCCAGGAGTTCGGG - Exonic
901059712 1:6466295-6466317 CGCTGCCGCCTAATGAGCTCAGG - Exonic
901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG + Intronic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
904915145 1:33964761-33964783 CGCTGCAGCACTGGGAGTTCAGG + Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG + Intergenic
908997920 1:70180358-70180380 CGCTTGAGCCTAGGGAGTTCTGG - Intronic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1066688451 10:38003234-38003256 CGCAACCGACTCGGGAGTTGCGG - Intergenic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG + Intronic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1076640141 10:131910112-131910134 CGCTGCCACCTGGCGAGTTATGG - Intronic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1090332648 11:125943763-125943785 CCCTGCTGCCTCGGGAGGTGAGG - Intergenic
1096670900 12:53197739-53197761 CGCTGCGGCCTGGTGAGTTAGGG - Exonic
1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG + Intronic
1104960733 12:132487558-132487580 AGCCGCCGTCTCTGGAGTTCTGG - Intergenic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1112643727 13:101306167-101306189 GTCTGCAGCCTCGGGAGCTCTGG - Intronic
1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG + Exonic
1114647521 14:24263845-24263867 CGCTGTAGCCTCGGGGGTTAGGG + Intronic
1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG + Intronic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1122094838 14:99363194-99363216 ACCTGCCGCCTCGGGACCTCAGG - Intergenic
1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG + Exonic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1147015631 17:37489677-37489699 GGCTGCTGCCTCGGGAGCTAGGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1155297362 18:24397675-24397697 GGCCACCGCCTCGGGAGCTCTGG - Exonic
1158401052 18:57121924-57121946 CGATCCCGCCTCGGGAGGCCAGG - Intergenic
1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG + Intronic
1161504084 19:4634700-4634722 TGCTGCCTCCTCTGTAGTTCTGG + Intergenic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG + Intronic
1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG + Exonic
925971748 2:9111073-9111095 CGCTGCCTTCCCTGGAGTTCTGG - Intergenic
930156451 2:48111826-48111848 CGCTGCGGTCTCGGGTGTTCAGG - Intergenic
934648711 2:96074384-96074406 CGCTGCCTCCTCGGCAATGCAGG + Intergenic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944154113 2:196593144-196593166 CGGAGCCGCCTCGAGAGCTCTGG - Intronic
947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG + Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1172174522 20:32964139-32964161 CGCTGGAGCCTGGGGAGTTGAGG - Intergenic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG + Exonic
1180996022 22:19965746-19965768 CAGTGCCTCCTCGTGAGTTCAGG - Intronic
1182951647 22:34381749-34381771 TGCTGGTGCCTCGGGAGCTCAGG + Intergenic
1184036287 22:41919860-41919882 CTCTGCGCCCTCGGGAGTCCGGG - Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
964386786 3:156156055-156156077 CTCTGGCCCCTCTGGAGTTCAGG + Intronic
966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG + Intergenic
968679272 4:1905487-1905509 CGCTGCCCCCACAGGAGCTCAGG - Intronic
969044589 4:4327693-4327715 CGCTGTAGCCCTGGGAGTTCAGG - Intergenic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998938714 5:147257589-147257611 CGCTGCCCCCTCCAGAGTTGTGG - Intronic
1002895583 6:1378382-1378404 CTGTGCCGCCTCGCGAGTCCTGG + Intergenic
1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG + Exonic
1013836723 6:114342887-114342909 AGCTGCCGGCTCGGGCGCTCTGG - Exonic
1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG + Intergenic
1023799458 7:43821375-43821397 CGCTGCCCCCTCCAGAGTTGTGG + Intergenic
1029713782 7:102314639-102314661 CGCTGCCGCCCGGGGATTCCAGG - Exonic
1034986850 7:155521544-155521566 GGCTGCCGCCTGGCGATTTCAGG - Intronic
1039875184 8:41578591-41578613 CCCTCCCGCCCCGGGAGTCCGGG + Intronic
1041023056 8:53657697-53657719 TGCTGCCGCCTAGGCAGTTGGGG - Intergenic
1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG + Intergenic
1049724174 8:144137856-144137878 CGCTGGCGCCTCGGGAGGGCCGG + Exonic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1060434536 9:123582246-123582268 CGCTGCCACCTCTAGAGATCAGG - Intronic
1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG + Intronic
1187016660 X:15335526-15335548 GGCTGCAGCCGCGGGAGGTCCGG - Intronic
1190191348 X:48279812-48279834 CGCTGCAGCCTTGGGACTACAGG + Intergenic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1200066102 X:153504760-153504782 CGCTGACACCTCGGGCGTCCTGG + Exonic