ID: 921220627

View in Genome Browser
Species Human (GRCh38)
Location 1:212971186-212971208
Sequence AAATATCCATCGATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921220627_921220633 28 Left 921220627 1:212971186-212971208 CCTTTATCCATCGATGGATATTT 0: 1
1: 0
2: 4
3: 36
4: 194
Right 921220633 1:212971237-212971259 AATGATGCTGTTCAGAGCATGGG 0: 1
1: 0
2: 0
3: 28
4: 347
921220627_921220632 27 Left 921220627 1:212971186-212971208 CCTTTATCCATCGATGGATATTT 0: 1
1: 0
2: 4
3: 36
4: 194
Right 921220632 1:212971236-212971258 AAATGATGCTGTTCAGAGCATGG 0: 1
1: 0
2: 1
3: 24
4: 282
921220627_921220629 -3 Left 921220627 1:212971186-212971208 CCTTTATCCATCGATGGATATTT 0: 1
1: 0
2: 4
3: 36
4: 194
Right 921220629 1:212971206-212971228 TTTGCGTTGTTTCCACCTTCTGG 0: 1
1: 10
2: 255
3: 1144
4: 2649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921220627 Original CRISPR AAATATCCATCGATGGATAA AGG (reversed) Intronic
902731340 1:18371662-18371684 AAATATCCATTGATAGAAATGGG + Intronic
906750630 1:48256098-48256120 AAAAATCCATCAGTAGATAAAGG + Intergenic
909002456 1:70234951-70234973 AGAAATCCATTAATGGATAAAGG - Intronic
909442196 1:75709878-75709900 AAATATCCATCAATGAATTCTGG + Intergenic
910538509 1:88327670-88327692 AAGTACCCATCAATGAATAATGG - Intergenic
911531706 1:99051400-99051422 AAAAATCCATCAATAAATAAAGG - Intergenic
911879170 1:103212145-103212167 CCATGTCCATTGATGGATAAAGG + Intergenic
912105581 1:106269424-106269446 AAGTATCCATCAATGGCAAATGG - Intergenic
913708098 1:121448617-121448639 AAATATACATGGAAGAATAAAGG + Intergenic
916120226 1:161522968-161522990 AAATAGCCATCTATGGAGTAAGG + Intronic
916644007 1:166764172-166764194 AAATATATGACGATGGATAAAGG + Intergenic
918461130 1:184777830-184777852 GAATATCCTTTGATGTATAAAGG - Intergenic
919044462 1:192433324-192433346 AAGTGTCCATCAATGGATGAGGG + Intergenic
919514269 1:198502123-198502145 AAATGTCCATTGGTGGATAAAGG - Intergenic
920410719 1:205758596-205758618 AAATACCCATCAATAGATAAAGG + Intergenic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921636853 1:217505772-217505794 AAATAACCATAGATGGCTAGTGG - Intronic
1063404301 10:5777886-5777908 AAATATCCATCAATGGTAGACGG + Intronic
1065439426 10:25735363-25735385 AAATATCCATCAATGAATGAAGG + Intergenic
1071165019 10:82796001-82796023 AAATATGAATCGATTGGTAAAGG - Intronic
1071947088 10:90657729-90657751 AAATAGTTATCTATGGATAAAGG + Intergenic
1073412573 10:103354303-103354325 CAATATCCATCAACTGATAATGG + Intergenic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1075134470 10:119771348-119771370 AAACATCCATCAAGGGATGAAGG - Intronic
1076926519 10:133492308-133492330 AAATATCCATCAATAGATGATGG + Intergenic
1078734112 11:14003961-14003983 AAATATGCAGAGATAGATAAGGG - Intronic
1081064860 11:38529194-38529216 AAATACCCATCCATAGATGACGG + Intergenic
1085188498 11:74596990-74597012 AAATGTCCATTAATGGATAAAGG - Intronic
1085557102 11:77434235-77434257 AAATATCCATGAACTGATAAAGG + Intronic
1087303245 11:96459730-96459752 AAAAATCCATTGAAGGAGAATGG + Intronic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1090301202 11:125641142-125641164 ACATATCCCTCTGTGGATAAGGG + Intronic
1090763685 11:129858402-129858424 AAATATTCATCAGTAGATAAAGG - Intronic
1095412864 12:41943675-41943697 AAATGTCCATCAAAGGAGAATGG - Intergenic
1095621990 12:44267890-44267912 AAATGTCCACTGATGAATAATGG - Intronic
1096762996 12:53859078-53859100 AAATGTCCATCAATTGATAATGG + Intergenic
1098267900 12:68741208-68741230 AAAGATCCATGTATGTATAAAGG + Intronic
1099032913 12:77550672-77550694 AAATATACATCCATGTATAAAGG + Intergenic
1099039036 12:77627778-77627800 AAGTATCCATTAATGGATGAAGG + Intergenic
1101548842 12:105742669-105742691 AGATTTCCATCCAGGGATAAGGG - Intergenic
1101871332 12:108567945-108567967 AAACCTCCATCGATGCATTAAGG - Intronic
1102698693 12:114820010-114820032 ACGTGTCCATTGATGGATAATGG - Intergenic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109458268 13:62622899-62622921 AAGTGTCCATCCATGGATAAAGG + Intergenic
1109813771 13:67551551-67551573 AAATATTCATCAAAGGATAATGG - Intergenic
1110716077 13:78705693-78705715 AAATATCAATCAATGAAAAAAGG + Intergenic
1111204294 13:84984186-84984208 AAGTGTCCATCAATGGATGAAGG + Intergenic
1113819435 13:113202470-113202492 AAATATCCATCCATAGAGACAGG + Intronic
1117009597 14:51456750-51456772 AAGTGTCCATCAATGGAAAATGG + Intergenic
1118481574 14:66172697-66172719 AAATATCCATCCTTTGAAAATGG + Intergenic
1118792691 14:69109715-69109737 AAATATCCATCAAAAGAAAATGG - Intronic
1120062304 14:79998702-79998724 AAATATGTATCAATGGAAAATGG + Intergenic
1120120251 14:80670327-80670349 AATCATCCATTGATGGATACAGG - Intronic
1120346076 14:83292025-83292047 AAATTTCCATCCATATATAAAGG + Intergenic
1120868214 14:89313729-89313751 AAATGTCCCTCGATGGCGAATGG + Intronic
1122351720 14:101098909-101098931 AAGTATGCATCAGTGGATAATGG - Intergenic
1122430849 14:101641771-101641793 AAATGTCCTTCAATGGATGATGG + Intergenic
1123495396 15:20818617-20818639 AAATGTACATCGATGGGTAGAGG - Intergenic
1123551884 15:21387732-21387754 AAATGTACATCGATGGGTAGAGG - Intergenic
1123805789 15:23871303-23871325 ATATATCCATCAAAGAATAATGG - Intergenic
1124357926 15:29011228-29011250 CAATGTCTATCGATGGATGATGG - Intronic
1124428454 15:29584394-29584416 AATCATCCATTGATGGATGAAGG + Intergenic
1125229564 15:37437702-37437724 AATTATCCATCAATGGATACCGG - Intergenic
1125817126 15:42595444-42595466 TAATAGCCATTGATTGATAATGG - Intronic
1125856732 15:42957123-42957145 AAATGCCCATCTATGGATGAAGG + Intronic
1126302438 15:47213091-47213113 AAATAGCCATACATGGCTAATGG - Intronic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1127193275 15:56555728-56555750 AAATGTCCATGGATGGATAAAGG - Intergenic
1131018912 15:89081381-89081403 AAATGTCCATTGATGGATGAAGG - Intergenic
1202960230 15_KI270727v1_random:114948-114970 AAATGTACATCGATGGGTAGAGG - Intergenic
1133332580 16:4984429-4984451 AAATGTCCATCAACGGATGAGGG - Intronic
1134050288 16:11132449-11132471 AAATGTGCATTGATGGATGAAGG - Intronic
1135709546 16:24703624-24703646 AAATGTCCATCAATGAATGAAGG - Intergenic
1136772676 16:32855532-32855554 AAATATGCATCCATGGATTTTGG - Intergenic
1136897938 16:34005987-34006009 AAATATGCATCCATGGATTTTGG + Intergenic
1138313494 16:56048357-56048379 AAAAGTCCATTGATGGATGAAGG + Intergenic
1138538727 16:57675103-57675125 AAATGTCCCTCAATGGATAACGG + Intronic
1140794131 16:78420366-78420388 AAATATCCATCATTGGTGAATGG + Intronic
1203075101 16_KI270728v1_random:1117642-1117664 AAATATGCATCCATGGATTTTGG - Intergenic
1144174960 17:12696309-12696331 CAGTGTCCATCGATGGACAAAGG - Intronic
1144922587 17:18776808-18776830 AAATGTCCATCAATGGGCAATGG + Intronic
1145715734 17:27018781-27018803 AAATGTCAATCAATGGACAAAGG + Intergenic
1149130949 17:53301797-53301819 AAGTGTACATCAATGGATAAAGG + Intergenic
1149437515 17:56645537-56645559 ATAGATGGATCGATGGATAATGG + Intergenic
1149453777 17:56770770-56770792 AAATATGGATGGATGGATGAAGG - Intergenic
1150438434 17:65172070-65172092 AAATGTCCAACAATGGAAAATGG + Intronic
1150527718 17:65940487-65940509 ATGTATCCATTGAAGGATAAAGG + Intronic
1151007611 17:70455929-70455951 AAATATCCATCGATGAAGACTGG - Intergenic
1152219567 17:79055478-79055500 AAATGTCCATCAGTGGGTAACGG + Intergenic
1153031355 18:716118-716140 AAACATCCATCAATTGGTAAAGG + Intergenic
1153422573 18:4924618-4924640 AAATATCCATCAGTTGATGAGGG + Intergenic
1154452799 18:14491100-14491122 AAATGTACATCGATGGGTAGAGG - Intergenic
1155744457 18:29335333-29335355 AAATGTCCATCAATAGAGAATGG + Intergenic
1156738782 18:40298522-40298544 AAGTGTCCATCAATGGATGATGG - Intergenic
1161987798 19:7666870-7666892 AAGTGTCCATCGATGGATGAAGG + Intergenic
1162649988 19:12080644-12080666 AAAGATCCATCAGTGGTTAAGGG + Exonic
1163220809 19:15918685-15918707 AAATATACATTGATGGAAAGAGG + Intronic
1163884162 19:19951170-19951192 AAATGCCTATCAATGGATAAAGG + Intergenic
1165556305 19:36635587-36635609 AAGTCTCCATCAATGCATAATGG - Intergenic
925602499 2:5623342-5623364 AAATGTCCATCAATTAATAAGGG + Intergenic
926875197 2:17468461-17468483 TAGTGTCCATCAATGGATAATGG - Intergenic
927954098 2:27196037-27196059 AAATATCCATAGAGTGAAAATGG - Intergenic
928548035 2:32346294-32346316 AAGTATCCATCGATGGCTGATGG - Intergenic
929278675 2:40053975-40053997 CATTATCCATTGATGGACAATGG - Intergenic
929278676 2:40053976-40053998 CATTGTCCATCAATGGATAATGG + Intergenic
930985343 2:57579584-57579606 GAATATCCATAAATGGGTAAAGG + Intergenic
931625061 2:64250002-64250024 CAATATCTAACGATGAATAAAGG - Intergenic
931917621 2:66975383-66975405 AAATGTCCATCAATGGATGATGG + Intergenic
933481663 2:82865440-82865462 AAACATGCATAGATAGATAAGGG + Intergenic
935433811 2:103006701-103006723 AAATATCCATGAATGCACAAAGG - Intergenic
939052706 2:137327599-137327621 AAATATTTAATGATGGATAAAGG - Intronic
939877848 2:147598341-147598363 AAATATCCTTGAGTGGATAAAGG - Intergenic
940989031 2:160079298-160079320 AAATATCCATCAACAGATGATGG - Intergenic
943120649 2:183730785-183730807 AAATAGTCATCAATGGAAAATGG + Intergenic
943245683 2:185448015-185448037 TATTATCCATTGATGGATACTGG + Intergenic
944124433 2:196277370-196277392 AAATATCCATCCAGGGATATGGG - Intronic
1169764009 20:9129062-9129084 AAGTGTCCATTGATGGATGAGGG - Intronic
1169930781 20:10830636-10830658 AAATATCCATACATGGATGAAGG + Intergenic
1170190126 20:13637488-13637510 AAATGTCCATCGACCGATGATGG + Intronic
1172961216 20:38801496-38801518 AAATATCCATCAAATGATAATGG - Intergenic
1173309229 20:41881889-41881911 AAATGTTCAGGGATGGATAATGG - Intergenic
1174347532 20:49941467-49941489 AAAAAGACATCAATGGATAATGG - Intronic
1174765749 20:53252513-53252535 AAATATCCATCAATGGAGATGGG - Intronic
1174884565 20:54318341-54318363 AAATAGCCATAGATGAAAAATGG - Intergenic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1181014166 22:20059276-20059298 AAGTGTCCATTAATGGATAAAGG - Intronic
949632818 3:5947342-5947364 ATATTTACATAGATGGATAAAGG - Intergenic
951347795 3:21567118-21567140 AAATGTTCATCGATGGCAAATGG - Intronic
951350706 3:21603468-21603490 AAGTATCCATCTATAGATATTGG + Intronic
952513151 3:34077092-34077114 AATTAACCATCTATGGACAATGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954761042 3:52874159-52874181 AAATGTCCATCGATAGGGAAGGG + Intronic
955633591 3:61001408-61001430 AAATATCCTTCAATGGATAATGG + Intronic
955765339 3:62338553-62338575 AAATATCCAGAGATGGATGGTGG + Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957410328 3:79831619-79831641 AAATGTCCATCAATGGATGGAGG + Intergenic
959130024 3:102343196-102343218 AAATACCCATCCATAGATTAGGG - Intronic
959676595 3:109042681-109042703 ACATGTCCATCAATAGATAAAGG + Intronic
964162481 3:153662321-153662343 AAATGTCCATCAATGGATGTTGG - Intergenic
964693045 3:159474831-159474853 AAACATCCAAGGATGGATACAGG - Intronic
966989537 3:185215259-185215281 AAATGTCCATCAACTGATAATGG + Intronic
970888539 4:21014860-21014882 CAATGTCCATTGATGGATGAAGG + Intronic
972286702 4:37656105-37656127 AAATTCCCATCGATAGACAAAGG + Intronic
973205957 4:47560383-47560405 AAATAACCATCAAAGGAGAATGG + Intronic
974016202 4:56651553-56651575 AAATCTCCATCAATGGGCAAGGG - Intronic
974217400 4:58867830-58867852 AAATATCCATAGATTGCTCAAGG + Intergenic
974545179 4:63295813-63295835 AAATAAGAATAGATGGATAAAGG - Intergenic
976747711 4:88421182-88421204 AAATATCCATCAATTGAGGAAGG - Intronic
977367262 4:96086118-96086140 AAATGTCCTTCAATGGATGATGG + Intergenic
978324314 4:107534756-107534778 AAATATCCATCCATGGAGGCTGG + Intergenic
979286771 4:118934897-118934919 AAATAAACACCGATGAATAAAGG - Intronic
981857254 4:149309269-149309291 ACATATCCCCCGCTGGATAAAGG - Intergenic
983102224 4:163638762-163638784 ATTCATCCATCGATGGACAATGG - Intronic
983587213 4:169368970-169368992 AAAAATCAATCAATGGAAAATGG - Intergenic
984219050 4:176950966-176950988 AAATATCCATCCTGGAATAAAGG + Intergenic
988875639 5:35443221-35443243 ATTTATCCATTGAGGGATAATGG - Intergenic
988891806 5:35625618-35625640 ATACATCCATAGATGAATAATGG + Intronic
988919019 5:35923498-35923520 AAATGTCCACCTATGGATAAAGG + Intronic
989392618 5:40917517-40917539 AAGTGTCCATCAAAGGATAAGGG - Intronic
991618390 5:68519695-68519717 AAATAGCCATCTATGGCTAGTGG - Intergenic
992094652 5:73351576-73351598 AAATATTCATCAACTGATAAAGG + Intergenic
992950792 5:81856145-81856167 AAACATCCTGCCATGGATAATGG - Intergenic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
996698565 5:126425290-126425312 AAGTGTCTATCAATGGATAAAGG + Intronic
997216098 5:132112114-132112136 AAATAGCCATATATGGCTAATGG + Intergenic
998271956 5:140714540-140714562 AAATGTCCATTGACGGACAATGG - Intergenic
998272792 5:140722084-140722106 AAATGTCTATCGATGGATGATGG - Intergenic
998830763 5:146155916-146155938 AAATATCCATTAATAGAGAATGG + Intronic
1000305693 5:159992489-159992511 AAATGTCCATCAACTGATAAAGG + Intergenic
1001978684 5:176022292-176022314 AAATATCCATCAATGGTAACTGG + Intronic
1002238732 5:177821470-177821492 AAATATCCATCAATGGTAACTGG - Intergenic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1005573449 6:27169669-27169691 AAATATCCATCAACTGATAAAGG - Intergenic
1009624261 6:66118229-66118251 AAGTGTCCATCAATGGATGAAGG + Intergenic
1009675644 6:66816167-66816189 AAATATCTATCAGTGGATGAAGG + Intergenic
1010134797 6:72538856-72538878 AAGTGTCCATCAATAGATAATGG - Intergenic
1010858004 6:80867582-80867604 AAGTGTCCATCAATGGAAAATGG + Intergenic
1012449475 6:99339576-99339598 AAATATCCTCCAATGGATAAAGG + Intronic
1012544424 6:100401502-100401524 AAATACACATCGATGTATTAAGG + Intronic
1013358389 6:109368719-109368741 AAATTTCCATGGATGCATATAGG - Exonic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG + Intergenic
1019655031 7:2188116-2188138 ACATAACCATGCATGGATAAAGG + Intronic
1019859957 7:3649008-3649030 AAATGTCCATGGATGCATGAAGG - Intronic
1021699454 7:23303421-23303443 AAGTGTCCATCAATGAATAAGGG - Intronic
1022172931 7:27846888-27846910 AAATAGCAATCTATGGATTAGGG - Intronic
1024168573 7:46759979-46760001 AAATACCCATTTATGGAGAATGG - Intergenic
1024411800 7:49051625-49051647 AAATTCTCATTGATGGATAATGG + Intergenic
1026531563 7:71203038-71203060 AAGTGTCCATCAATGGATGATGG - Intronic
1028938533 7:96492816-96492838 AAATGTCCATTGAAGGATGAAGG - Intronic
1029743415 7:102503748-102503770 AAAGACCCATCTATGGAGAAAGG - Intronic
1029761404 7:102602909-102602931 AAAGACCCATCTATGGAGAAAGG - Intronic
1029937385 7:104441468-104441490 AAATATCCATTAATGGATAATGG - Intronic
1030973945 7:116097251-116097273 ACATATCCTCCCATGGATAAAGG - Intronic
1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG + Intergenic
1034586435 7:152097600-152097622 AAATATCCATCAACTGATGAAGG + Intronic
1035826620 8:2651861-2651883 AAGTATCCATCGATTGAAGATGG - Intergenic
1036218333 8:6899603-6899625 AAATATCTAGAGATGGATAGTGG - Intergenic
1036944816 8:13085171-13085193 AAATACCCATAAATGGACAAGGG + Exonic
1037386243 8:18345303-18345325 AAATATTCATTGTTGAATAATGG + Intergenic
1038344065 8:26715908-26715930 AAATATCCATCCATAGAGAGTGG - Intergenic
1039667971 8:39557082-39557104 AAATATCCATCTATTGATGAAGG - Intergenic
1043270039 8:78321759-78321781 AAATATACATGGAAGAATAAGGG + Intergenic
1044154864 8:88832533-88832555 AAAACTCCCTCTATGGATAAAGG + Intergenic
1044849652 8:96416176-96416198 AAATATCCATCAATAGAGAAAGG + Intergenic
1045304596 8:100948238-100948260 AAATGTACATCTGTGGATAAAGG - Intronic
1046069925 8:109238386-109238408 AAATATCCATCTACAGATGAAGG - Intergenic
1048614297 8:136057476-136057498 AAGTGTCCATCAATAGATAAGGG + Intergenic
1051004132 9:12321379-12321401 AAATAGCCATATATGGATAATGG - Intergenic
1051305449 9:15703645-15703667 AAGTGTCCATCAATGGATAAAGG - Intronic
1051399824 9:16668666-16668688 AATTATACATCTGTGGATAAGGG - Intronic
1051478670 9:17536326-17536348 AAATATCCATCAATGACGAATGG - Intergenic
1051789769 9:20788068-20788090 AAATATCCATCCATTGATAGTGG + Intronic
1052617421 9:30858641-30858663 ACATATACATAGATGGATAACGG - Intergenic
1055855746 9:80685726-80685748 AAATGTCCATCAATGGATAAAGG + Intergenic
1055987506 9:82066480-82066502 AAATGTCCATCCATGGTGAATGG + Intergenic
1056061693 9:82889863-82889885 AAATATCCAACAGTGGACAAAGG - Intergenic
1056510870 9:87304393-87304415 AAATGTCCATCAACTGATAATGG + Intergenic
1056861746 9:90191268-90191290 AAATGTCCATCAATGAATGAAGG - Intergenic
1059643881 9:116244910-116244932 AAGCATCCATCAATGGATGATGG + Intronic
1060601215 9:124879162-124879184 AACTTTCCATCACTGGATAATGG + Exonic
1185837970 X:3362514-3362536 AAGTGTCCATCAATGGATGATGG + Intergenic
1185918221 X:4059854-4059876 ATATATGGATAGATGGATAAGGG - Intergenic
1186264730 X:7819892-7819914 AAGTGTCCAACAATGGATAAAGG - Intergenic
1186281381 X:7996768-7996790 AAATATCCATATTTGAATAAAGG - Intergenic
1187355158 X:18562368-18562390 AAATAGCCATCCATGAAAAATGG + Intronic
1188294003 X:28423666-28423688 AATTATCCATTGATGGACACAGG - Intergenic
1191647762 X:63501656-63501678 AAGTATCTATTGATGAATAAAGG + Intergenic
1196256660 X:113528079-113528101 AAATGTCCATCAATGGAAAATGG - Intergenic
1196280208 X:113815328-113815350 AAATATTCATCAATAGATCATGG + Intergenic
1196413691 X:115447572-115447594 AAATTTATATCGATGAATAAAGG + Intergenic
1197250783 X:124214506-124214528 AAATATCCATCTAGGGTCAATGG + Intronic
1199363821 X:146954430-146954452 AAATATCCATCAAAGGTTAATGG - Intergenic
1199946593 X:152674265-152674287 AAATATCCTTCCATGGGTATTGG + Intergenic
1201237878 Y:11929212-11929234 AAGTGTCCATCAATGGATGATGG - Intergenic