ID: 921220741

View in Genome Browser
Species Human (GRCh38)
Location 1:212972039-212972061
Sequence CTGAGCTTTTCCAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921220741 Original CRISPR CTGAGCTTTTCCAGGGAAGG GGG (reversed) Intronic
900117554 1:1034984-1035006 GTGGACTCTTCCAGGGAAGGGGG + Intronic
900413639 1:2525249-2525271 CCCAGCTTTTCCAGGGAGGTGGG + Intronic
900645969 1:3708881-3708903 CTGAGCTGTGCCCGGGGAGGCGG - Intronic
901392910 1:8958836-8958858 CTTAAGATTTCCAGGGAAGGAGG - Intronic
901763726 1:11487198-11487220 CTCAGCTTTTCCTGGGGTGGGGG - Intronic
902690959 1:18109889-18109911 CTGCGCATTCCCAGGGAAAGGGG - Intronic
903833421 1:26188352-26188374 CTGTGCCTTTCCTGGGATGGGGG + Intronic
904744844 1:32704113-32704135 CCGAACTATTCCAGGGGAGGAGG + Intergenic
905171131 1:36110410-36110432 CTGAGCTTTTGAAGAGATGGAGG - Intronic
905878066 1:41446004-41446026 TTGAGCTTTTCCAACCAAGGCGG + Intergenic
907420305 1:54342567-54342589 CTGGGCTTTACCACGGTAGGTGG - Intronic
908170707 1:61501697-61501719 CTCACCCTTTCCAGAGAAGGTGG - Intergenic
908929744 1:69304235-69304257 GTGAGCATTGCCAGGGAAGAAGG - Intergenic
910678888 1:89843170-89843192 CTGAGCCTTTGCAGGGGAGTAGG - Intronic
913009609 1:114670110-114670132 CTGAGCCTTGCCAGGGAGGGCGG - Intronic
914234617 1:145797290-145797312 ATGAGTTTTGCCAGAGAAGGAGG - Intronic
914881010 1:151547218-151547240 CTGGGCTTTGCCAGAGAAGGAGG + Intronic
916075465 1:161197830-161197852 CTGAGCCTTACCAAGAAAGGAGG + Intronic
916813943 1:168332545-168332567 CTGTGCTTTTCTAGGGAAATGGG + Intergenic
917783473 1:178425966-178425988 CTGAACCTTTCCAGAGTAGGTGG - Intronic
918361557 1:183764194-183764216 ATGAGCATTGCCAGGGAAGAAGG + Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
920004587 1:202823714-202823736 ATAAGCTTTTCTAGGGAAAGAGG - Exonic
920045650 1:203130488-203130510 TCCAGGTTTTCCAGGGAAGGTGG + Intronic
921213773 1:212920723-212920745 CTGTGCTCTCCCAGGGAAGAGGG + Intergenic
921220483 1:212970186-212970208 CTGACCTTTTCCAGGGAAGCGGG - Intronic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
921250616 1:213294271-213294293 CTGAGTTTTGCCAAGGAGGGTGG + Intergenic
921349556 1:214221754-214221776 ATGAGCAATTCCAGGGAAAGTGG + Intergenic
923735820 1:236605768-236605790 CTGACATTCTCCAGGGAAGACGG - Intergenic
1062820515 10:531265-531287 CTGAACGTTTACAGGGAAAGTGG - Intronic
1064051647 10:12065000-12065022 CTGAGATTTTGTATGGAAGGTGG - Intergenic
1066012647 10:31209028-31209050 GTGAGCTGTTCAGGGGAAGGCGG - Intergenic
1066507842 10:36063919-36063941 CTGAGATTTTACGGGGAAGCTGG + Intergenic
1070231886 10:74576529-74576551 CTCATTTTTTCCAGGGAAGAAGG - Intronic
1070484919 10:76921014-76921036 CTGAGCCTTTCCAGGGAGAGAGG + Intronic
1070626372 10:78054056-78054078 GTGAGCTTTCCCAGGGTATGGGG + Intronic
1072240717 10:93493235-93493257 CTAAGATTTTCCGGGGAAGTAGG + Intergenic
1072437010 10:95423091-95423113 CTGAGCTTTGCCAGGCACTGTGG - Intronic
1072784992 10:98273362-98273384 CTGAGCTTCCCCAGGCAAGGAGG - Intergenic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073169247 10:101489075-101489097 CTAAGTTTTTTCAGGGAAGAGGG - Intronic
1073977367 10:109116730-109116752 ATGAGTATTTCCAGGGAAGAAGG + Intergenic
1075255925 10:120926107-120926129 CTTAGCTGCTCCTGGGAAGGAGG + Intergenic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077282133 11:1750618-1750640 CTGGGCTTTTCCAGGGGATTAGG - Intronic
1077739193 11:4826318-4826340 CTCAACTTATCCAGAGAAGGTGG - Intronic
1077893944 11:6440019-6440041 CCAAGCTTTTACAGGAAAGGAGG + Intronic
1078879180 11:15431339-15431361 CTTAGCCTTTCCAAGGAAGCAGG - Intergenic
1078903871 11:15666474-15666496 GTGAGCTTTCACAGGAAAGGAGG + Intergenic
1079083747 11:17431008-17431030 CTGAGCGTTTCCAGTGTGGGAGG - Intronic
1079641333 11:22809190-22809212 ATGAGTATTGCCAGGGAAGGAGG + Intronic
1080149042 11:29026106-29026128 CAGAGATTTTTCAGGGTAGGGGG - Intergenic
1080389330 11:31829823-31829845 ATGAGTTTCTCCAGGGAATGTGG - Intronic
1080475137 11:32583548-32583570 CTTAACATTTCAAGGGAAGGTGG + Intergenic
1081154861 11:39677480-39677502 CTGAGCCTAGCGAGGGAAGGAGG + Intergenic
1081961012 11:47137441-47137463 CAAAGCTTTTCCAGGGTGGGAGG - Intronic
1082020003 11:47524523-47524545 CTGAGGTTTTCAAGTGAAAGAGG - Intronic
1083141896 11:60728949-60728971 ATCAGCTTTGCCAGGGCAGGGGG + Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1083562111 11:63681359-63681381 CTGCGCTCTTGCAGGGAAGGAGG - Intergenic
1083675443 11:64322527-64322549 CTGAGCTCTTCCTGGGATGAGGG - Intergenic
1085803320 11:79611640-79611662 GTGAGCCTTTCAAGGAAAGGAGG - Intergenic
1086934918 11:92734439-92734461 CTGACCTTGTCCAGGGCAGTAGG + Intronic
1087717456 11:101625158-101625180 CTGAGCTTCTCCTGGGAGGGGGG - Intronic
1088267518 11:108001857-108001879 CTGAGCGTTTTTAGGGAATGGGG - Intergenic
1089667747 11:120031143-120031165 TTGAGCTTATCTAAGGAAGGTGG - Intergenic
1089977673 11:122746535-122746557 CTGAGATCTTCAAGGGTAGGAGG - Intronic
1090097056 11:123752651-123752673 CTGAGCATTGCCAGGGAAGAAGG - Intergenic
1091006415 11:131957701-131957723 CTGAAATTTTCTAGGGTAGGAGG - Intronic
1091278252 11:134366918-134366940 CTGTCCTCTTCCAGGGAAGGGGG - Intronic
1091318471 11:134632672-134632694 CTGAGCTCATGCTGGGAAGGTGG + Intergenic
1091387659 12:105063-105085 CTGCCCTTTTCTAGGGAAAGAGG - Intronic
1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG + Intronic
1093028316 12:14264855-14264877 CTGCACTTTTGCAGGGAAGGAGG + Intergenic
1095631012 12:44377413-44377435 CTGAGCTTTGCCACAGAAGTAGG - Intronic
1097398344 12:59102657-59102679 CTCTGCTTTTCTGGGGAAGGGGG + Intergenic
1097611776 12:61832255-61832277 GTGAGCTTTGCAAGGGAAGCAGG - Intronic
1098483361 12:70991909-70991931 TCGTGATTTTCCAGGGAAGGAGG - Intergenic
1099708628 12:86190888-86190910 CCGAGGTTTTCCAGAGAAGAAGG + Intronic
1100330761 12:93579809-93579831 CTGAGCTTTGTCAGCAAAGGAGG + Intronic
1100677524 12:96884256-96884278 CTGAGATTGCCCAGGGAAGAGGG - Intergenic
1101039039 12:100735729-100735751 CTGAGCTGTTCCCAGGAATGTGG + Intronic
1101828847 12:108241533-108241555 AGGAGCTTTTCCAGGGTAAGGGG + Intronic
1102792110 12:115655793-115655815 CGGGGCTTTTCCAGAGGAGGAGG + Intergenic
1103245609 12:119454478-119454500 CTGAGCGTGTCCAGGGCAGCTGG - Intronic
1104083843 12:125457072-125457094 CTGAGCTTTCGAAGGGCAGGTGG - Intronic
1104286933 12:127432213-127432235 CTGAGCTTTCGAAGGGCAGGTGG + Intergenic
1104382413 12:128319059-128319081 CTGAGATGTTCCAGTGAGGGAGG + Intronic
1105785112 13:23740717-23740739 CCCTGCTTTTCCAGTGAAGGTGG - Intronic
1106422223 13:29594467-29594489 CTGACCCTTTCCAGGGGATGGGG - Intronic
1106636536 13:31534625-31534647 CTAAGCATTAGCAGGGAAGGGGG - Intergenic
1107283973 13:38768612-38768634 CTGAGCATTTTCAGAGAAGTGGG - Intronic
1107562294 13:41568360-41568382 CTGTGGTTTGCCAGGGCAGGAGG - Intronic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1109311575 13:60700598-60700620 CTGAGGTTTTCCAAAGAAGAAGG - Intergenic
1109501269 13:63238791-63238813 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1111318595 13:86593979-86594001 TTGAGGTTTCCCAGAGAAGGGGG + Intergenic
1112398042 13:99051264-99051286 CTGAGCTTTGGCGGGAAAGGGGG - Intronic
1112594313 13:100793966-100793988 GTGAGCTTCTCCAGGGAGGTAGG - Intergenic
1114277290 14:21158357-21158379 CTGTGCTATCCCAGGGATGGGGG - Intergenic
1115640442 14:35332392-35332414 CTGGGGTTTTCCAGGGATAGAGG + Intergenic
1117446055 14:55804837-55804859 TTTACCTTTTCCAGGGCAGGAGG + Intergenic
1118768811 14:68928256-68928278 CCTGGCTTTTCCAGGAAAGGGGG - Intronic
1119569940 14:75661302-75661324 CTGAGCCTTCCTGGGGAAGGAGG + Exonic
1120021317 14:79534058-79534080 CTGATTTTTTCCAAGGAAGAAGG - Intronic
1120361919 14:83514903-83514925 CTGTGATTTTGCAGGGAGGGAGG + Intergenic
1120999934 14:90444224-90444246 CTGTGCCTCTCCAGGGCAGGGGG + Intergenic
1121334244 14:93067372-93067394 CAGAGCTCTGCCAGGGCAGGTGG - Intronic
1122119476 14:99544363-99544385 CTAAGCTTTGCCTGGCAAGGAGG + Intronic
1122879172 14:104682337-104682359 CTGAGCTCTTCCAGGGTGGGAGG - Intergenic
1124795229 15:32771727-32771749 CTGAACTTTTCCTGGAGAGGAGG - Exonic
1127301148 15:57655103-57655125 CTGAGCTATCACAGAGAAGGGGG + Intronic
1127682015 15:61306634-61306656 CTGAGCTGAACCAGGGAAGTGGG + Intergenic
1127976250 15:63999299-63999321 CCGAGCCTTTCCAGGGCACGTGG + Intronic
1128127130 15:65201444-65201466 CTGAGCTTGGCCAGGCACGGTGG + Intronic
1128131306 15:65228812-65228834 CTGAGCGTTACCAGGGACTGGGG - Intergenic
1128258646 15:66216566-66216588 CTGTGCTATGCCAGAGAAGGTGG - Intronic
1128613791 15:69094011-69094033 CTGAGCTTTTCCAGCCAGGCTGG + Intergenic
1128767855 15:70261982-70262004 GGAAGCTTTCCCAGGGAAGGTGG - Intergenic
1129416813 15:75388217-75388239 CTGAGCTATTCTATGGAAGAGGG + Intronic
1130965451 15:88694386-88694408 CTCACATTTTCCAGAGAAGGTGG + Intergenic
1131167423 15:90152495-90152517 ATGAGCTTTGCCAGGGAGGGAGG + Intergenic
1132031347 15:98440655-98440677 CTGGGCTTTTGCAGTGGAGGAGG + Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134092716 16:11400001-11400023 CTGAGCTCTTCCAGAGATGGGGG - Intronic
1134898850 16:17915970-17915992 CTGAGCTTTTCCATGGCATATGG - Intergenic
1135960957 16:26994208-26994230 TAGAGCATTTCCAGGGAAGGCGG + Intergenic
1138386910 16:56642087-56642109 GTCAGCTTTTCAAGGGAAAGAGG - Intronic
1138387626 16:56647190-56647212 CTCAGCTTTTCAAGGCAAAGAGG - Intronic
1141163385 16:81644284-81644306 CTACAATTTTCCAGGGAAGGAGG - Intronic
1141558855 16:84853673-84853695 CTGATGCTTTCCAGGGAAGATGG - Intronic
1141664031 16:85456704-85456726 TTAAGCATTTCCAGGGAGGGAGG + Intergenic
1141826255 16:86482431-86482453 ATGAGGTTTTCCTGGGATGGAGG + Intergenic
1141840617 16:86571949-86571971 CTGGGCCTTTCAAGGAAAGGTGG + Intergenic
1142682862 17:1560766-1560788 CGGAGCTTTTCCTGGTGAGGAGG - Intronic
1143497663 17:7321654-7321676 CGGAGCTCTGGCAGGGAAGGAGG + Exonic
1144018811 17:11222108-11222130 CTCTGCTTTTCCAGGGAATAGGG - Intergenic
1144701809 17:17345294-17345316 CAGAGCTCCTGCAGGGAAGGTGG + Intronic
1146002400 17:29139247-29139269 GTGAGCATCCCCAGGGAAGGGGG - Intronic
1148519999 17:48264606-48264628 CTGAACTTTGCCAGGAAATGGGG + Intronic
1149005239 17:51798224-51798246 CTGAGCTTCTATAAGGAAGGAGG - Intronic
1149570798 17:57671076-57671098 CTGGGCTTTCCCAGTCAAGGTGG - Intronic
1150715957 17:67572779-67572801 AGGAAGTTTTCCAGGGAAGGGGG + Intronic
1152295500 17:79464870-79464892 CTGAGCTTCTGCAGGGACTGAGG - Intronic
1156557500 18:38084092-38084114 CTGAGCTCTTCTAGGGAAGATGG - Intergenic
1157518036 18:48324823-48324845 CTGGGCTGGTCCAGGGAAGGGGG + Intronic
1157981696 18:52389058-52389080 CTGAGCAGTTCCAGGGAGGGTGG - Intronic
1158430634 18:57383195-57383217 ATGAGCTTTTCCTAGGAAAGAGG - Intergenic
1160395384 18:78567037-78567059 CTGATGCCTTCCAGGGAAGGTGG - Intergenic
1160510586 18:79451343-79451365 CTGAGCATGGCCAGGGAAAGCGG + Intronic
1160555361 18:79721131-79721153 CTGAGCGGCTCCAGGGTAGGAGG - Intronic
1160751789 19:737854-737876 GTGGGCTTTTCCCGGGAGGGAGG + Intronic
1161081932 19:2315586-2315608 CTGTTGTTTTCCAGAGAAGGGGG + Intronic
1161280889 19:3445301-3445323 CCGGGCTTTTCCAGGGCAGGAGG - Intronic
1161672494 19:5622131-5622153 CAGAGCATTTACAGGAAAGGGGG - Intronic
1162744041 19:12789424-12789446 CAGAGCTACTCTAGGGAAGGAGG + Intronic
1162895581 19:13763155-13763177 CTGAGCTCTCCCAGGGCTGGTGG - Exonic
1162922229 19:13909928-13909950 TTGAGCTTCTCCAGGGCTGGGGG - Exonic
1163621537 19:18363729-18363751 CGGAGCTTTTGTAGAGAAGGAGG - Exonic
1164553883 19:29234896-29234918 CTGTGCTTTTCTAGGGATAGGGG - Intergenic
1165121877 19:33565136-33565158 GTGAGCATTTCCTGGGATGGAGG + Intergenic
1165176427 19:33933746-33933768 CACAGCCTTTCAAGGGAAGGAGG + Intergenic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1165358022 19:35315937-35315959 CTGAGCTTCTCCTTGGAAGCCGG - Intergenic
1166439932 19:42804490-42804512 ATGAGCATTGCCAGGGAAGAAGG + Intronic
1166468454 19:43056025-43056047 ATGAGCATTGCCAGGGAAGAAGG + Intronic
1167189747 19:47976687-47976709 GTGAGATTTACCAGGGGAGGGGG - Intronic
1167410657 19:49341861-49341883 GTCAGCTTCACCAGGGAAGGAGG + Intronic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
1168526893 19:57095761-57095783 CTGAGGTTTTCCAGGGTGGTAGG + Intergenic
925024795 2:599227-599249 CTGTGCTTTTCCAGCAAGGGAGG - Intergenic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926891503 2:17643167-17643189 CTGAGCTTTGTGAGGGCAGGAGG - Intronic
928087848 2:28356825-28356847 CTTAGCCGTTCCAGGGAGGGAGG - Intergenic
928228372 2:29475237-29475259 CTGAGGTCTTCCAGCGATGGTGG - Intronic
928286257 2:29992493-29992515 CTGAGTTTTGCCAGGTAAGCAGG - Intergenic
933641284 2:84762911-84762933 CAGAGGTTTGCCAGGGAAAGTGG + Exonic
938087786 2:128412586-128412608 CTGAGATTCTGCAGGGCAGGTGG + Intergenic
939265620 2:139868847-139868869 CTGAGATTTTCCAGAAAAAGTGG + Intergenic
939303654 2:140380943-140380965 AAAAGCTTTTCCAGGGAAAGTGG + Intronic
939519939 2:143217503-143217525 CTGAACTCTTCAAGGGAAGGTGG - Intronic
942983650 2:182112742-182112764 TTGTGCTTTTTCAGGGAAGGAGG - Intronic
944579433 2:201118829-201118851 CTGAGCTTGTCCGGCGAGGGTGG + Intronic
945493733 2:210484835-210484857 ATCAGTTTTTCCAGGGAAGAAGG - Intronic
946404740 2:219486376-219486398 CTGAGTTTTACCAGGAAATGGGG - Intronic
946648746 2:221868630-221868652 CTGATCTCTTCCTGGGATGGAGG + Intergenic
947807125 2:232976671-232976693 CTGACAATTTACAGGGAAGGTGG - Intronic
947915406 2:233829094-233829116 CTGAGCTTGCTCAGTGAAGGAGG + Intronic
948050678 2:234977231-234977253 CTGAGCTTCTCCCCGGCAGGAGG - Intronic
948099741 2:235364390-235364412 CTGCTCTTTTGCAGGGTAGGGGG + Intergenic
948352961 2:237355811-237355833 CTCAAATTTTCCATGGAAGGTGG - Intronic
1169182012 20:3577594-3577616 CTGAGCTTGTTCAGGGAAGTTGG + Intronic
1169218168 20:3805153-3805175 CTGGGCTCTTCCAGGGGTGGGGG - Exonic
1169280147 20:4260262-4260284 CTGAGATTTTCCAGAGAGGAAGG - Intergenic
1173132510 20:40408085-40408107 CTCAGCATTCCCAGGGAAAGTGG - Intergenic
1173172896 20:40741856-40741878 GTGAGCTTTTCCTGGAAAGTGGG + Intergenic
1174376307 20:50128851-50128873 CCCAGCTTCTCCAGGGATGGAGG - Intronic
1176970477 21:15259881-15259903 CTGAGCTATTCCACAGAAAGTGG + Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179011760 21:37561883-37561905 CTGATGTGATCCAGGGAAGGCGG - Intergenic
1179031809 21:37727154-37727176 TTGAGCTTTTGGAGGGAGGGTGG + Intronic
1179380502 21:40894797-40894819 CTGAGCTACTCCACAGAAGGTGG - Intergenic
1179481001 21:41678657-41678679 CTGGACTTCTCCAGGGCAGGCGG + Intergenic
1179707546 21:43190995-43191017 CTGAGCTGTTGCAGGGTAGGGGG - Intergenic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180785170 22:18543190-18543212 CCGAGCTTTTCAAGAGAAGATGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180962387 22:19767730-19767752 TTGTGCTTTTCCATGGAAGCTGG + Intronic
1181116421 22:20634958-20634980 ATGAGCTTCTCCAGGGCAGGTGG - Intergenic
1181128752 22:20717231-20717253 CTGAGCTTTTCAAGAGAAGATGG - Intronic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181242073 22:21482543-21482565 CCGAGCTTTTCAAGAGAAGATGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181646405 22:24233585-24233607 CTGCCCTACTCCAGGGAAGGTGG - Exonic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1182691122 22:32164132-32164154 ATGAGCTGTTCCAGGCAAGAGGG + Intergenic
1183734266 22:39635355-39635377 CTGCGCTTCTCAAGGGCAGGGGG - Intronic
1184238478 22:43199306-43199328 CTGGGCTTGTCCACGGCAGGAGG - Exonic
1184301965 22:43566784-43566806 ATGAGCTTTTCCAGGGGTAGGGG - Intronic
1185134073 22:49058833-49058855 CTGATCTTGGCCAGGGAAGAGGG - Intergenic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949452146 3:4197549-4197571 CTGTTCTTTTCCAGAGAAGCAGG - Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
951412411 3:22380842-22380864 CTGAGAGCTTTCAGGGAAGGGGG - Intergenic
952789811 3:37190853-37190875 CTAAGCTTATCAGGGGAAGGAGG + Intergenic
953136871 3:40189373-40189395 CTGAGGTCTGCCAGGGCAGGTGG + Intronic
953138572 3:40205650-40205672 AGGAGCTTTTGCAGGGAGGGTGG - Intronic
953749085 3:45595786-45595808 CTGAGCTGCCCCAGGCAAGGAGG + Exonic
954868865 3:53751694-53751716 CTGAGCACTTGCAGGGAAGGAGG - Intronic
954973890 3:54675087-54675109 CTGGGCTTTTTCAGAGGAGGAGG + Intronic
955066291 3:55536227-55536249 TTGAGTTTGTCCAGTGAAGGAGG - Intronic
955928413 3:64030797-64030819 CTGGGCTTTTCCGAGGAAAGGGG - Intergenic
956171826 3:66438961-66438983 CAGCTCTTTTCCAGGGAATGGGG + Intronic
956864583 3:73356647-73356669 CAGAGCTCTTCCAGGGAAATGGG - Intergenic
956864647 3:73357054-73357076 CTGAGATCTTCCAGGGAAGAGGG - Intergenic
957920251 3:86738028-86738050 TTGAGCTTTTACAGTGAAGTAGG + Intergenic
959441862 3:106386452-106386474 ATGAGTATTTCCGGGGAAGGAGG - Intergenic
960443710 3:117721367-117721389 GTGAGCTTCACAAGGGAAGGAGG + Intergenic
961003882 3:123391670-123391692 CTTAGCTTTTCCAGGGCCTGGGG + Intronic
962046548 3:131765989-131766011 CTGGGCTATGACAGGGAAGGTGG + Intronic
963897111 3:150698752-150698774 CTTAGCTTTTCCTGGGAGGAGGG - Intronic
971431896 4:26577060-26577082 CTGAGGTTTTCTAGAGAAGAAGG + Intronic
974317315 4:60298819-60298841 CTGATCTATTCCTGGGAAAGGGG - Intergenic
975280030 4:72551127-72551149 CTGACCATTTCAAGGGAAAGAGG + Intronic
977804733 4:101283622-101283644 CTGACAGTTCCCAGGGAAGGAGG - Intronic
977992678 4:103463329-103463351 CTTAATTTATCCAGGGAAGGGGG + Intergenic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
980411042 4:132419379-132419401 ATGAGTATTGCCAGGGAAGGAGG + Intergenic
985588660 5:753649-753671 CTGCTCTTCTCCAGGGGAGGAGG + Intronic
985603329 5:846088-846110 CTGCTCTTCTCCAGGGGAGGAGG + Intronic
985840467 5:2301565-2301587 ATGAGCTTTTCCACGGAAGCTGG - Intergenic
986126100 5:4883580-4883602 CTGAGCTTTTCCAAGGAACCAGG - Intergenic
987878523 5:23711507-23711529 CTGAGCTTTGCCTGGCGAGGTGG - Intergenic
989103047 5:37838305-37838327 CTTCGCTTTGTCAGGGAAGGTGG - Intronic
992571651 5:78065350-78065372 CTGAGCTTTGGCAGGGGAAGGGG + Intronic
992937049 5:81718605-81718627 CAGAGCTTTCCCAGTGAAGCTGG - Intronic
994086503 5:95765454-95765476 CTGTGCTTTCCCAGGGTAAGGGG + Intronic
994104968 5:95937309-95937331 CTGAGCTCTTCAAGGGCAAGGGG + Intronic
994723925 5:103412474-103412496 CTCAGCTTCTACAGTGAAGGAGG - Intergenic
995629522 5:114118239-114118261 CTGAGGTTTTTTAGGGAACGGGG - Intergenic
997115597 5:131122907-131122929 CTGAGATTGTCCTGGGAAGCGGG - Intergenic
997612840 5:135227281-135227303 CTGAGCTCTTCACAGGAAGGTGG + Intronic
998227389 5:140337491-140337513 CTGTGCTTTCTCTGGGAAGGAGG + Intronic
998825094 5:146093415-146093437 CTGAGCACTTCCAGGGAGGAGGG - Intronic
999231550 5:150065038-150065060 CTGAGCTCTTCCTGGGAGTGGGG + Intronic
999400907 5:151263596-151263618 CTGAGCTTTTACTGGCAGGGAGG + Intronic
999492143 5:152061630-152061652 CTGGCCATATCCAGGGAAGGGGG + Intergenic
1000407507 5:160904080-160904102 GGGAGCTTTTCCAGGGGAGCAGG - Intergenic
1002905186 6:1442625-1442647 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1003238107 6:4316775-4316797 CAGTTCTTTTCCAGGGAAGCAGG + Intergenic
1003923959 6:10859537-10859559 CTGAGGTTTCCCAGAGAAGGAGG + Intronic
1005589356 6:27309231-27309253 CTTAGCTTGTCCAGGGACTGGGG + Exonic
1006164416 6:32056222-32056244 CTCAGGTCTTCAAGGGAAGGAGG + Intronic
1006339725 6:33440265-33440287 CTGAGCCATTCCAGGGACTGGGG + Intronic
1006946910 6:37790799-37790821 CAGAGCTTTTGAAGGGAAGGAGG + Intergenic
1007102820 6:39261720-39261742 CTGAGCCATTCCAAGCAAGGGGG - Intergenic
1007700302 6:43762460-43762482 CTGAGCCCCTCTAGGGAAGGAGG + Intergenic
1007943100 6:45800462-45800484 ATGAGCTGTCCCTGGGAAGGTGG - Intergenic
1009397229 6:63213543-63213565 ATGAGAATTTCCAGGGAAGAAGG - Intergenic
1010568912 6:77454213-77454235 CTGACCTCTTCTAGGGAAGTTGG - Intergenic
1013068365 6:106705323-106705345 CTGAGTATTGCCAGGGAAGAAGG + Intergenic
1013592423 6:111630639-111630661 CTGGGCTTTAACAGGGAAAGTGG - Intergenic
1015426655 6:133077981-133078003 CTGAGGCTTTCCTGGGAATGAGG - Intergenic
1016856480 6:148675683-148675705 TGGAGCTGGTCCAGGGAAGGTGG + Intergenic
1018395912 6:163377921-163377943 CTGCGCTGCTCCAGGGAAGGAGG - Intergenic
1018775633 6:167012766-167012788 GTGAGTTTTTCCAGAGAAGGGGG + Intronic
1019052429 6:169193289-169193311 ATGAACTTTTTCAGGGCAGGTGG + Intergenic
1019308604 7:347986-348008 CTGAGCCATTCCTGAGAAGGTGG + Intergenic
1019344726 7:523638-523660 CGCAGCTTTTCCTGGGCAGGTGG - Intergenic
1019611735 7:1940181-1940203 CTGTGCTTCTCCTGGGAAGGAGG + Intronic
1019772243 7:2891023-2891045 CAGAGCCTTTTTAGGGAAGGAGG - Intergenic
1019906437 7:4068596-4068618 CTGAGCTGTACCAGGGATGGGGG + Intronic
1021293493 7:18874934-18874956 CTGTGCTTTTCCAGGGAGAATGG + Intronic
1021604333 7:22395111-22395133 CTGAGTATTGCCAGGGAAGAAGG - Intergenic
1022040832 7:26579812-26579834 CTCCTCTGTTCCAGGGAAGGTGG + Intergenic
1022455202 7:30552586-30552608 CTGACCTCTTCCAGGCAAGAAGG - Intergenic
1023305983 7:38827445-38827467 CTGAACTTTTCAAGGCAAGAGGG - Intronic
1023360991 7:39414811-39414833 CTGAGTTTTGCTGGGGAAGGAGG - Intronic
1024584244 7:50827394-50827416 ATGAGTTCTTCCAGGGATGGGGG - Intergenic
1028115176 7:86988743-86988765 CTTAGATTCTCCAGGGGAGGGGG - Intronic
1028856329 7:95597514-95597536 CTGATCTCTTTCAGGAAAGGGGG - Intergenic
1031182145 7:118432774-118432796 CTGAGCTCATGCAGGGAAGCAGG - Intergenic
1035005230 7:155652694-155652716 AGGAGATTTTCCAGGTAAGGAGG + Intronic
1035705324 8:1670419-1670441 CTGAGCTTTGCAGGGGAAGCTGG - Intronic
1037558373 8:20049191-20049213 ATGAGTATTGCCAGGGAAGGAGG - Intergenic
1037754654 8:21703066-21703088 CTGGACCATTCCAGGGAAGGGGG - Intronic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1038482612 8:27912039-27912061 CTGAGCTTTCAGAGGGAACGTGG + Intronic
1039008985 8:33072574-33072596 CTGATCTTTGCCAGGCATGGTGG - Intergenic
1047107081 8:121744339-121744361 CTGAGCACTTTCAGCGAAGGAGG - Intergenic
1047919120 8:129615067-129615089 TTGAGCTTTGGAAGGGAAGGGGG - Intergenic
1049205561 8:141361920-141361942 CTGAGCTCCTCCAGGGGAGGGGG + Intronic
1049530670 8:143153291-143153313 CTGCCCCTGTCCAGGGAAGGAGG - Intergenic
1049708603 8:144053856-144053878 CTGAGCAGCTGCAGGGAAGGGGG - Intronic
1049813451 8:144586701-144586723 CAGAGCCTGCCCAGGGAAGGGGG + Intronic
1050128449 9:2384098-2384120 GTGATCTTTTCCTGGGAAGATGG - Intergenic
1051780710 9:20685339-20685361 TTGAGATTTTCCAGGAGAGGAGG + Intronic
1052074672 9:24126384-24126406 CTGAACTTCTCAGGGGAAGGGGG + Intergenic
1055053011 9:71998578-71998600 CAGTGCTTATCCAGGGAAGGAGG + Intergenic
1055851783 9:80640473-80640495 AGGTGCTTTTCCAAGGAAGGAGG - Intergenic
1055924467 9:81495575-81495597 CTGAGAATCTACAGGGAAGGGGG + Intergenic
1057118754 9:92551082-92551104 CAGAGCATTTCCTGGGGAGGTGG + Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057840329 9:98481101-98481123 CAGAGCTCTGCCTGGGAAGGTGG + Intronic
1059838940 9:118190921-118190943 ATGAACTTTTCCAGAGAAAGAGG + Intergenic
1060212989 9:121721865-121721887 CTGAGCATTTTCAGGGCAGCTGG + Intronic
1060270259 9:122135139-122135161 GAGAGCTTTTCCAGGCAAGAGGG - Intergenic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1061672921 9:132199100-132199122 CTGAGCTTTTCCACGGAAGAAGG + Intronic
1061809805 9:133155688-133155710 CTGAGCTTTTTCTGTGCAGGTGG - Intronic
1061865035 9:133487790-133487812 CTCGGCTTTTCCAGGGCAGTAGG - Intergenic
1186910845 X:14163643-14163665 CTGAACTTTTCAGGAGAAGGTGG + Intergenic
1188187486 X:27132044-27132066 ATGAGTATTTCCAGGGAAGAAGG - Intergenic
1189296213 X:39920087-39920109 TCGAGGTCTTCCAGGGAAGGGGG + Intergenic
1190410890 X:50136104-50136126 CTGAGCTTGGCCAGGGTATGAGG - Intergenic
1198084729 X:133271218-133271240 CTGAGCAGTTCCAGTCAAGGAGG + Intergenic
1199879081 X:151958698-151958720 CTCAGCTTTTCCCGGATAGGTGG - Intronic