ID: 921221074

View in Genome Browser
Species Human (GRCh38)
Location 1:212974326-212974348
Sequence TGAAATGCAGGTGGCCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921221069_921221074 4 Left 921221069 1:212974299-212974321 CCAGGCAGAATGAGGTGAAGAAT 0: 1
1: 1
2: 1
3: 17
4: 217
Right 921221074 1:212974326-212974348 TGAAATGCAGGTGGCCCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
921221068_921221074 5 Left 921221068 1:212974298-212974320 CCCAGGCAGAATGAGGTGAAGAA 0: 1
1: 0
2: 5
3: 24
4: 294
Right 921221074 1:212974326-212974348 TGAAATGCAGGTGGCCCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
921221067_921221074 6 Left 921221067 1:212974297-212974319 CCCCAGGCAGAATGAGGTGAAGA 0: 1
1: 0
2: 5
3: 16
4: 225
Right 921221074 1:212974326-212974348 TGAAATGCAGGTGGCCCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921221074 Original CRISPR TGAAATGCAGGTGGCCCGGA GGG Intronic