ID: 921221967

View in Genome Browser
Species Human (GRCh38)
Location 1:212979829-212979851
Sequence CTGTGGTTCGTAAAGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921221962_921221967 27 Left 921221962 1:212979779-212979801 CCTCTGGGAGTGTGTAAAGCACC 0: 1
1: 0
2: 0
3: 13
4: 97
Right 921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 133
921221963_921221967 6 Left 921221963 1:212979800-212979822 CCTACTACACTGAATTGTCAAGT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921221967 Original CRISPR CTGTGGTTCGTAAAGAGAAA GGG Intronic
901697421 1:11019105-11019127 CTATGGATGGAAAAGAGAAAAGG + Intronic
902111782 1:14085154-14085176 CTGTGGTTCTCAGAGATAAATGG - Intergenic
902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG + Exonic
902868419 1:19296584-19296606 ATGTGGTTGATAAAGAAAAAGGG + Intergenic
903240936 1:21982176-21982198 CTGGGGTGAGTAGAGAGAAAAGG + Intronic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
914958183 1:152183528-152183550 CTGTGATTAGTATGGAGAAATGG - Intergenic
916727887 1:167539741-167539763 CCATGGTTGGTAAAGACAAATGG + Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
918549903 1:185730423-185730445 CCGTAGTTGGGAAAGAGAAAAGG - Intergenic
919149535 1:193678257-193678279 TTGTGCTTGGAAAAGAGAAAAGG - Intergenic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921693719 1:218183083-218183105 GGGTGATTCATAAAGAGAAAAGG + Intergenic
922469343 1:225866308-225866330 CTGTGGGCGGCAAAGAGAAAGGG + Intronic
923925855 1:238626547-238626569 CTGTGGCTTGTAACAAGAAAAGG + Intergenic
1066469211 10:35681794-35681816 CTGTGGTTTGTGAAGAGACATGG - Intergenic
1067024671 10:42834083-42834105 CTGTGCCTAGTAAATAGAAAAGG - Exonic
1068556752 10:58466975-58466997 CTATGGTTCGAAGAGGGAAAGGG - Intergenic
1070940448 10:80340828-80340850 TTGTGAATCTTAAAGAGAAAGGG + Intronic
1076133026 10:128026749-128026771 CTTTGCTTGTTAAAGAGAAAAGG - Intronic
1079001401 11:16760136-16760158 CTGTGTCTCGAAAAGAAAAAAGG - Intergenic
1087260970 11:96011941-96011963 CTGTGCTTGTTAAAAAGAAAAGG + Intronic
1092978146 12:13765919-13765941 CTGTGCTTCCTAAAGAAACAAGG - Intronic
1096223606 12:49849051-49849073 CTCTGGTTGATAAACAGAAAAGG + Intergenic
1098871008 12:75816947-75816969 CTGTAGATTATAAAGAGAAATGG + Intergenic
1099566124 12:84248719-84248741 CTGTTGTTGGAAAAGAAAAAAGG - Intergenic
1102063980 12:109957409-109957431 GGGTAGTTCGTAAAGAAAAAAGG - Intronic
1102452052 12:113049275-113049297 CTGTGGTCCCCAAAGACAAAGGG + Intergenic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1106329470 13:28726152-28726174 GTGGGGTTTGTCAAGAGAAATGG + Intergenic
1107145001 13:37051965-37051987 CTGTGATTTGTAAAGTGAACTGG - Intronic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1111239266 13:85453542-85453564 ATGTGGTTACTATAGAGAAAAGG - Intergenic
1113575592 13:111393173-111393195 CTGTAGTTCATAAGGAGAGAGGG - Intergenic
1114896370 14:26995520-26995542 ATGTGGTTCAGAAATAGAAAAGG - Intergenic
1115797426 14:36954365-36954387 CTGTAGTTAGTAAGGAGAAATGG - Intronic
1116836043 14:49769632-49769654 ATGTGGTTAGAAAATAGAAAGGG + Intronic
1117642172 14:57811574-57811596 CTTTGTTTTCTAAAGAGAAAAGG + Intronic
1121822440 14:96982428-96982450 CTCTGGCTCTTAAATAGAAATGG + Intergenic
1125225734 15:37393770-37393792 ATGTGTTTCTTAAAGAGATATGG - Intergenic
1135048473 16:19173236-19173258 CTGCAGTTGGTAAATAGAAATGG + Intronic
1138713980 16:59000714-59000736 ATGGGGTTGATAAAGAGAAAGGG - Intergenic
1138920215 16:61518482-61518504 CTTTGGCTCTTAAAGAGAAGAGG + Intergenic
1139656260 16:68388865-68388887 CTGTGGTTCGTGAAAGGATAGGG - Intronic
1142922275 17:3199597-3199619 CTGTGGGTCATTCAGAGAAAGGG - Intergenic
1146536476 17:33657149-33657171 GTGTCGTTCGTAAGGAGAATGGG - Intronic
1146965042 17:37019605-37019627 CTGTGGTTGGAAAATAAAAAGGG + Intronic
1147017036 17:37500159-37500181 CTTTGATTTGTAAAGAAAAATGG + Intronic
1151696831 17:75722143-75722165 CTGTGCTTGGCCAAGAGAAAAGG - Intronic
1151869682 17:76827857-76827879 CTGTGGCCTGGAAAGAGAAACGG - Intergenic
1153264969 18:3261546-3261568 ATGCGGTTTGAAAAGAGAAAGGG + Intergenic
1154054872 18:11003283-11003305 CTGTGGTTTGTTAAGTGAATTGG - Intronic
1155106970 18:22676747-22676769 CTGTAGTTGGTTAAGAGTAAGGG - Intergenic
1155892004 18:31281757-31281779 CTGTGGTTCCAAAAGATAAGTGG + Intergenic
1159259305 18:65991297-65991319 CTTTGGTTGGTAAAGGGAAATGG - Intergenic
1166762117 19:45231637-45231659 CAGAAGTTCGTAAAGGGAAAAGG + Intronic
927666739 2:25038116-25038138 ATGTGGTTCCTAAGGAGATAGGG - Intergenic
928819615 2:35343858-35343880 CTGGGGGTGGTAAAGAGAACTGG - Intergenic
929205919 2:39292737-39292759 CTGTTTTTGGTAAAAAGAAAAGG - Intronic
930871675 2:56177473-56177495 CTGTTGTTTGTAAAGAAAATTGG - Intergenic
932116676 2:69056555-69056577 CTCTGGTGAGGAAAGAGAAATGG - Intronic
937482811 2:122280265-122280287 CTGTCTTGCGAAAAGAGAAAAGG - Intergenic
937656420 2:124381825-124381847 CTGTGGTTGATGAAGAGAATGGG + Intronic
940143014 2:150515430-150515452 CAGTGGTTGGTAAAGATACAGGG - Intronic
940480372 2:154221907-154221929 CTGTAATTCTCAAAGAGAAATGG + Intronic
940543976 2:155059537-155059559 CTTTGTTTAGTAAAAAGAAATGG - Intergenic
941760142 2:169233280-169233302 GGGTGGTTTGTAAAGAGAAAAGG + Intronic
1169933248 20:10856424-10856446 CTGTGGATGATAAAAAGAAAGGG + Intergenic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1177391470 21:20478980-20479002 TTGTGGTTCATCAAGAAAAATGG + Intergenic
1185250110 22:49796923-49796945 CAGTGATTCATCAAGAGAAAGGG + Intronic
949589071 3:5474448-5474470 GTGTGGATGGTATAGAGAAAAGG - Intergenic
949744110 3:7268628-7268650 CTGGGCTTTGTAGAGAGAAAAGG + Intronic
950033061 3:9864486-9864508 CTGTGGTCAGTGAACAGAAAAGG - Intergenic
952153745 3:30620747-30620769 CTATGACTCATAAAGAGAAAAGG - Intronic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
956454726 3:69409374-69409396 CTGTGGTGCACACAGAGAAATGG - Intronic
956569074 3:70673684-70673706 ATGTGGATGGTAAAGAGAAGAGG - Intergenic
956604525 3:71059811-71059833 CTTTAGTTCTTAAAGGGAAAAGG + Intronic
957667578 3:83253742-83253764 TTGTGGTTCTTAAATAGATAAGG - Intergenic
961335983 3:126180107-126180129 CTGAGGCTCGATAAGAGAAAGGG - Intronic
965257843 3:166439515-166439537 CTGTAGTTGGCAAAGAGTAATGG + Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
966401072 3:179547225-179547247 CTGTGGTTCTTAAAGAGTAGAGG - Intergenic
969259841 4:6026397-6026419 GTTGGGTTCGGAAAGAGAAATGG + Intronic
970076858 4:12232011-12232033 CTGTGGTTCAGAAAAAAAAAAGG + Intergenic
971130677 4:23806122-23806144 CTGTGTTTCATAAAAAGAGATGG - Intronic
973218964 4:47703974-47703996 CTTTGGCTCATAAACAGAAAAGG + Intronic
974070902 4:57122555-57122577 CTGTTGTTCCTATAGAGCAAAGG - Intergenic
975476085 4:74824888-74824910 CTCTGCTTCATAAACAGAAATGG - Intergenic
976110343 4:81666606-81666628 ATGTGGTTGGGACAGAGAAAAGG + Intronic
977009587 4:91620632-91620654 CTGTGATATCTAAAGAGAAAAGG - Intergenic
977558371 4:98507585-98507607 CTGTGGTTGTCAAAGAGAAAGGG + Intronic
978000088 4:103547031-103547053 CTGTGGTCCCAAAAGAGCAAAGG + Intergenic
979434113 4:120668960-120668982 ATTTAGTTAGTAAAGAGAAAGGG - Intergenic
979727885 4:123986335-123986357 CTGTTGTTTGTACAGAGAGAAGG - Intergenic
982052853 4:151520038-151520060 ATATGGTTAGTAAAGAGAATAGG - Intronic
985405337 4:189632865-189632887 CTGTGCTTAGTTAAGAGAATTGG + Intergenic
990702856 5:58494230-58494252 TTGTGATTCGTTAACAGAAAAGG + Exonic
990831034 5:59957550-59957572 CTGTTGGTAGTATAGAGAAAAGG + Intronic
994417073 5:99485477-99485499 TTGTGTTTCGAAAGGAGAAAGGG + Intergenic
994824308 5:104693918-104693940 ATGTGGTTATTGAAGAGAAATGG + Intergenic
995820877 5:116230759-116230781 CTTTGGATGGTAAAGAGAAACGG - Intronic
995821861 5:116244115-116244137 CTGTTGATAGTACAGAGAAATGG + Intronic
997911959 5:137883721-137883743 CTGTGGTTTGTAGATAAAAATGG - Intronic
998156829 5:139791927-139791949 CTGTAATAGGTAAAGAGAAATGG + Intergenic
1003016734 6:2474043-2474065 CTGGGGTTTGGGAAGAGAAATGG - Intergenic
1005013373 6:21356669-21356691 CTGTTGTTGCTAAAGGGAAATGG + Intergenic
1005242721 6:23850897-23850919 CTGTAGTTTGCAAACAGAAAAGG + Intergenic
1006013725 6:31063991-31064013 CTGGACTTCATAAAGAGAAAAGG - Intergenic
1008201593 6:48597816-48597838 TTCTGGTTCAAAAAGAGAAATGG + Intergenic
1008509488 6:52262961-52262983 CTTTGGTTCGTTAGGACAAAGGG - Intergenic
1009635719 6:66262214-66262236 CTGCTGTTCGTATAGTGAAAAGG + Intergenic
1009638686 6:66301713-66301735 ATGTGGTTCATATAGTGAAACGG + Intergenic
1010337465 6:74703719-74703741 AGTTGGTTCATAAAGAGAAAGGG - Intergenic
1012786994 6:103643142-103643164 CAGTGGTTTGTAAAGAGCATGGG - Intergenic
1014413946 6:121161124-121161146 CTCTGGATTGTAAAGAAAAAAGG + Intronic
1016339111 6:143042096-143042118 CTATGGGTCTTCAAGAGAAAGGG - Intergenic
1016675105 6:146756040-146756062 CTGTAGTTGTTAAAGAGAGAGGG - Intronic
1019593431 7:1847234-1847256 CAGTGCTTCCTAAACAGAAAAGG - Exonic
1022194813 7:28054622-28054644 CTGGGTTTCCTAAAGGGAAATGG - Intronic
1022380807 7:29858128-29858150 TTTTGGTTCTTAAAGTGAAATGG + Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1025778447 7:64578517-64578539 CTGTGGCTAGGAAAGATAAAAGG - Intergenic
1027347624 7:77277232-77277254 CTGTAATTTCTAAAGAGAAAAGG - Intronic
1027465503 7:78510102-78510124 TTGTAGTTCATAAAGAGAATAGG + Intronic
1036005104 8:4653101-4653123 CTGTGGCTGGGAAAGAGACAAGG - Intronic
1037878769 8:22562416-22562438 CTGTGGTTTGCACAGAGGAAAGG - Intronic
1038867288 8:31453651-31453673 ATGTGGTGGGTAAAGAGAAATGG + Intergenic
1041403278 8:57467346-57467368 CTCTGATTTGCAAAGAGAAAAGG - Intergenic
1042750776 8:72155283-72155305 CTTTGTATCATAAAGAGAAATGG + Intergenic
1045595807 8:103654606-103654628 CTGTGGTTCAGAAAGATAAAAGG - Intronic
1045634383 8:104166578-104166600 CTGTGCTTCGAAAAGTTAAATGG - Intronic
1050910227 9:11059053-11059075 CTGTGGTTTCTAAAGAGTGATGG + Intergenic
1051377239 9:16414802-16414824 CTGGGGTGTGTACAGAGAAAGGG + Exonic
1055240757 9:74183172-74183194 CTGTGGATGGTAAAGCTAAAAGG - Intergenic
1055282316 9:74688970-74688992 TTGTGGTCCATAAAAAGAAAGGG + Exonic
1060497445 9:124129006-124129028 CTGAGGTCCGGAGAGAGAAAGGG + Intergenic
1187134189 X:16530701-16530723 CTTTGGTTCTTACAGAAAAAAGG + Intergenic
1195431277 X:104792138-104792160 CTGAGGTTCAGAAAGAGGAAGGG + Intronic
1195887893 X:109659466-109659488 TTGTGGTTCCTAACCAGAAAAGG - Exonic
1197415663 X:126168892-126168914 CTGTGCTTCTTAAAGATAACCGG + Intergenic