ID: 921224747

View in Genome Browser
Species Human (GRCh38)
Location 1:213007138-213007160
Sequence AGCAGAGATCAGGCCAAGTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921224747_921224750 20 Left 921224747 1:213007138-213007160 CCAAACTTGGCCTGATCTCTGCT 0: 1
1: 0
2: 3
3: 15
4: 197
Right 921224750 1:213007181-213007203 TTCTTGCAAACAAAGTACCTTGG 0: 1
1: 0
2: 0
3: 20
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921224747 Original CRISPR AGCAGAGATCAGGCCAAGTT TGG (reversed) Exonic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
910089242 1:83442419-83442441 AGCCGAGATCACGCCAAGGAAGG + Intergenic
910726443 1:90344870-90344892 ATAAGAGATCATGGCAAGTTAGG - Intergenic
910814675 1:91279064-91279086 AGCAGAGATCAGTTCTAGATTGG - Intronic
912697178 1:111850234-111850256 AGCAGGGAACAGGCCAACTGAGG - Intronic
914695913 1:150079451-150079473 AGCTGAGATCACGCCAATCTGGG - Intronic
917268445 1:173246914-173246936 AGTAGAGATACTGCCAAGTTTGG - Intergenic
919752801 1:201048716-201048738 AGCTGGGACCAGGCCAAGCTTGG + Intronic
919974468 1:202601862-202601884 AGCAGAGATGAGGCCAGGTTGGG - Intronic
920940179 1:210474799-210474821 ACCTGAGGTGAGGCCAAGTTAGG - Intronic
921224747 1:213007138-213007160 AGCAGAGATCAGGCCAAGTTTGG - Exonic
921823925 1:219650247-219650269 AGCAGAGATCATGACAAGCCAGG + Intergenic
923480833 1:234381817-234381839 AGCAAAGTTCTGGACAAGTTGGG + Intronic
1063814979 10:9760934-9760956 AGCAGAGCTCGAGACAAGTTGGG + Intergenic
1067524828 10:47031901-47031923 AGCAGACAGCAGGCCCAGGTGGG + Intergenic
1067661100 10:48236667-48236689 AGCAGAAAACAGGCCAAGATGGG + Intronic
1067745010 10:48929118-48929140 AGCAGAGATCAGAGGAAGTGAGG + Intronic
1067769442 10:49112687-49112709 AGCAGAGATTAAACCATGTTGGG - Intronic
1067896998 10:50193310-50193332 AGGAGAATTCAGGCCAAGTCTGG + Intronic
1067951976 10:50748728-50748750 AGGAGAATTCAGGCCAAGTCTGG - Intronic
1072578659 10:96721450-96721472 AGCAGAGATGAGGCAAGGTTAGG + Intergenic
1072676681 10:97471799-97471821 AACAGAAACCAGGCCAGGTTCGG - Intronic
1074496775 10:113986544-113986566 GGCAGAGACCAGGCCACATTAGG - Intergenic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1080016777 11:27516058-27516080 AGCTGAGATCATGCCAAAGTTGG - Intergenic
1081266595 11:41031704-41031726 AGCTAAGATCAGGCAAAATTTGG + Intronic
1081400981 11:42642588-42642610 AGCAGAGAGCAGGCTAAGAAAGG + Intergenic
1081938700 11:46922416-46922438 AACTGAGATCAGGCCAACCTGGG - Intergenic
1081938709 11:46922462-46922484 AGCTGAGATCAGGCCAACCTGGG - Intergenic
1082781825 11:57293979-57294001 AGCCAAGATCATGCCAGGTTGGG - Intergenic
1082992720 11:59222123-59222145 TGCAGATATCAGGCAAAGATGGG - Intergenic
1083191107 11:61052952-61052974 TGCAGAGTTCAGGCCATGGTTGG - Intergenic
1083603397 11:63962377-63962399 AGGAGAGACCAGGCCAGGTAGGG + Intergenic
1083716280 11:64578841-64578863 AGCAGAGAAGAGGCCGAGTGCGG + Intergenic
1085658445 11:78339317-78339339 AAAAGAGAACAGGGCAAGTTTGG - Intronic
1087752103 11:102018333-102018355 AGATGAGAACAGGCCAAGTGTGG + Intergenic
1087982471 11:104633115-104633137 ATCAGATATCAGCCTAAGTTTGG + Intergenic
1089488093 11:118862643-118862665 TGCAGAGATCTGGCCGAGTTTGG + Intergenic
1092656386 12:10689304-10689326 AGCAGAGGCCAAGGCAAGTTGGG - Intergenic
1093169620 12:15845225-15845247 ATCAGAAAGGAGGCCAAGTTTGG + Intronic
1093726671 12:22520293-22520315 AGAAAAGATCAGGTAAAGTTGGG - Intronic
1096089113 12:48886785-48886807 AAAAGAGATAAGGTCAAGTTGGG - Intergenic
1100144847 12:91665049-91665071 AGCAGTGAACAGGCCAGATTTGG - Intergenic
1101748458 12:107562543-107562565 ATCAGAGATGAGTCCAAGGTGGG + Intronic
1102123674 12:110463127-110463149 AACATAAATCAGGCCAAGTGCGG + Intronic
1102394030 12:112573197-112573219 AACAGAGATCAGGCCAGGCATGG - Intronic
1103808986 12:123598847-123598869 AGCAGAGATCAAGCCAACCTGGG - Intergenic
1106199208 13:27522514-27522536 AACAGACAACAGGCCAAGTGGGG + Intergenic
1107002288 13:35562302-35562324 AACAGAAATCAGGTCAATTTGGG - Intronic
1107997832 13:45878270-45878292 ACCAGAGAACAGGCCATGTGAGG + Intergenic
1110292540 13:73823998-73824020 AGAAGAGGCCAGGCCAAGTGCGG - Intronic
1110451327 13:75640246-75640268 AGCAGAGCCCAGGCCAGGTGCGG - Intronic
1111456803 13:88495121-88495143 AGCAGAGTTCAGGAAAATTTAGG + Intergenic
1111485631 13:88895584-88895606 AGCAAAGATGAAGCCAAGCTTGG + Intergenic
1112459487 13:99590617-99590639 AGCAGAGACCAGGCGAAACTGGG - Intergenic
1112527485 13:100165739-100165761 AGCAGAGTTCAGGCCAGGTGTGG + Intronic
1113496799 13:110737149-110737171 AGCAGAAATCAGGCCAGGTGTGG - Intergenic
1113812240 13:113149840-113149862 AAGAGAGACCAGGCCAAGTGGGG - Intergenic
1116083457 14:40204813-40204835 AGCAGAGTTAAGGCCAAGCCAGG - Intergenic
1117676018 14:58155622-58155644 AGCAGATCTCAGGCCAGGTGTGG - Intronic
1119461096 14:74804387-74804409 AGCAGAGGTCAGGCCAGCTCAGG - Intronic
1126197676 15:45950236-45950258 AGCAGAGACAAGGCCAAGGAAGG - Intergenic
1126677383 15:51172160-51172182 AGCTGAGAGAAGGCCAAGTTTGG + Intergenic
1128666301 15:69540607-69540629 AGCACAGAACAGGGAAAGTTTGG - Intergenic
1128777946 15:70338021-70338043 AGCAGCAAACAGGCCAAATTTGG - Intergenic
1129302399 15:74632984-74633006 AGCAGAGAGCAGCCCAGGCTGGG + Intronic
1130804127 15:87300774-87300796 GGCAGAGGTCAGGCCTATTTTGG + Intergenic
1130831749 15:87608104-87608126 ATCACAGATCAGGCCAGGTACGG - Intergenic
1131100275 15:89683218-89683240 GGCAGAGATGAGGCCAAGAACGG - Exonic
1131370342 15:91875779-91875801 AGTAGAGAGCAGGCCAGGTTTGG - Intronic
1132411348 15:101580254-101580276 TGCGGGGGTCAGGCCAAGTTGGG - Intergenic
1135645806 16:24160811-24160833 AGCAGAGACCAGGGCAAGCAAGG + Intronic
1136076564 16:27821227-27821249 AGCAGAGATCTGGCCACACTGGG - Intronic
1139335960 16:66231428-66231450 AGCGGAGAGCAGGCCAGGGTGGG + Intergenic
1139662199 16:68428857-68428879 AGAGGAGACCAGGCCCAGTTGGG + Intronic
1140141313 16:72260642-72260664 AGCAGAAAGCAGGTCAACTTGGG + Intergenic
1141283861 16:82653385-82653407 AGGAGAGACCAGCCCAACTTTGG + Intronic
1143280444 17:5750332-5750354 AGCAGACAGGAGGCCAAGGTGGG - Intergenic
1143965957 17:10756655-10756677 AGGAGATATCTGGCCAGGTTTGG - Intergenic
1145262899 17:21365303-21365325 AGCAGAGATCAGGCCCATCTAGG - Intergenic
1146304855 17:31723082-31723104 CGCAGAGATGAGGCCATGTGAGG - Intergenic
1147990645 17:44330889-44330911 AGCTGGGATCAGCCCAATTTGGG + Intergenic
1155349559 18:24893148-24893170 AGCAGAGCTAAGGCCAAGGCAGG + Intergenic
1155568733 18:27166471-27166493 AACAGAGATCAACCCAAGGTTGG - Intronic
1158125194 18:54093132-54093154 AGAAGAGATCAGGCAGAGTAGGG + Intergenic
1158617032 18:58997363-58997385 AGCAGAGATCATGCCAGCCTGGG + Intergenic
1158994079 18:62899371-62899393 AGAAGAGCACAGGGCAAGTTTGG - Intronic
1164632399 19:29770132-29770154 CGCAGAGAGCAGGCCATGTGAGG + Intergenic
1166390051 19:42403981-42404003 AACAGAGCTGAGGCCAAGCTGGG - Intronic
1167426454 19:49432250-49432272 AGCAGAGAGAAGACCGAGTTGGG - Intronic
1168651752 19:58096578-58096600 AGCAGAGCTCAAGCCTGGTTTGG + Intronic
925027636 2:621859-621881 AGCAGAGCTCTGGCCACGTGGGG - Intergenic
925159279 2:1672709-1672731 TGCAGAGACCAGGCCAATTAAGG + Intronic
927215057 2:20663742-20663764 AGCAGAGATCAGAGAAGGTTGGG - Intergenic
930099714 2:47593845-47593867 TGCAGGGATTAGTCCAAGTTTGG - Intergenic
931655130 2:64504086-64504108 AGTAGAGATCAGGCCGGGTGTGG + Intergenic
932768484 2:74486600-74486622 AGTAGTGGTCAGGCCAAGTGTGG + Intronic
933046099 2:77539253-77539275 AAAAAAGATGAGGCCAAGTTTGG + Intronic
934555876 2:95286775-95286797 AGAAGAGATCAGGGCTGGTTAGG - Intronic
934766968 2:96885131-96885153 AGCAGGGATGAGGCCCATTTAGG + Intronic
934896812 2:98126803-98126825 AGCTGAGATCAGGCCACTTGAGG - Intronic
937973163 2:127565514-127565536 AGCAGAGATTGGGAAAAGTTAGG - Intronic
938972103 2:136442181-136442203 TGCTGAGCTCAGGACAAGTTTGG + Intergenic
942615958 2:177792607-177792629 AGGAGAGATCAGGCCTAGTTTGG + Intronic
943525946 2:189017597-189017619 AGAAGAGATCAGGCCAGGCATGG + Intergenic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1169753854 20:9023138-9023160 AACACAAATCAGGCCAAGTGTGG + Intergenic
1170192596 20:13658874-13658896 GGGGGAGATCAGGTCAAGTTGGG + Intergenic
1171188575 20:23141809-23141831 AGCAGAGATTAGGCAGTGTTGGG + Intergenic
1173310416 20:41891991-41892013 TCCAGAGAGCAGGCCAAGTCTGG - Intergenic
1174403610 20:50289812-50289834 GGCAAATATCAGGCCAGGTTTGG + Intergenic
1174673925 20:52335096-52335118 TGCAGAGATCAGGACAATATGGG + Intergenic
1175524826 20:59626446-59626468 TGCAGAGACCAGGCAAAGTGAGG + Intronic
1176081417 20:63275148-63275170 GGCAGTGATCAGCCCAAGTGTGG + Intronic
1179196982 21:39173536-39173558 AGCAGACATCAGGCCTGGGTAGG - Intergenic
1182425581 22:30270134-30270156 AGAAGAGATAAGGCCAAGCGCGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1183017071 22:34997518-34997540 AGCAAAGATCTGTCCAAGTAGGG - Intergenic
1184342238 22:43892220-43892242 ACCAGAGATCAGGCAAGATTTGG - Intergenic
1184971010 22:48019803-48019825 GGCAGACATGAGGCCAAGGTGGG + Intergenic
949798598 3:7878368-7878390 AGCTGAGTTCAGGCCAAAGTAGG - Intergenic
950283474 3:11726353-11726375 AGCTGAGACCAGATCAAGTTAGG + Intergenic
950972292 3:17201463-17201485 AGCAGAGATCAGGAAAAGAGAGG + Intronic
953899501 3:46831735-46831757 AGAACAGACCAGGCCAAGTTAGG + Intronic
954034970 3:47846538-47846560 AGCAGAGATGCGGCGAGGTTGGG - Exonic
954430992 3:50470761-50470783 GGCAGAGAGCAGGCCGGGTTGGG + Intronic
954946398 3:54428628-54428650 AGCAGAAATAAGGCCCATTTGGG - Intronic
955201841 3:56858681-56858703 AGCTGAGATCAGAACAAGGTGGG + Intronic
955403227 3:58608657-58608679 AGGAGAATCCAGGCCAAGTTTGG - Intronic
955490577 3:59477961-59477983 AGCAAAGATAAGGCCAGGTAAGG + Intergenic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
959231858 3:103664873-103664895 ACCAGAGATGAGGGCAAATTGGG - Intergenic
961500224 3:127327081-127327103 AGCAGAGATAAGGGCAGGCTAGG - Intergenic
961632036 3:128308188-128308210 AGCAGAGCTACGGCCAAGCTTGG - Intronic
962239554 3:133740374-133740396 AGCTGAGATCATGCCACATTAGG - Intergenic
964927338 3:161975254-161975276 AGCAAAGTTAAGGCCAAGCTTGG - Intergenic
966460886 3:180175159-180175181 AGAACAGATCAGGCCAGGTGGGG - Intergenic
966659499 3:182398593-182398615 AGCAAAGCTCAGGCCATGGTGGG + Intergenic
966776053 3:183543523-183543545 AACAGAGATTAGGGAAAGTTAGG - Intronic
967828145 3:193895340-193895362 GGCAGGGATCAGGCCAAACTTGG - Intergenic
968272712 3:197416816-197416838 TCCAAAGATCTGGCCAAGTTAGG + Intergenic
969459713 4:7322474-7322496 AGCGGAGATGAGGCCAACTCTGG - Intronic
971428884 4:26542774-26542796 AGCATCGTTCTGGCCAAGTTAGG + Intergenic
972151814 4:36100707-36100729 AGCAGTGATTATGCCCAGTTTGG - Intronic
972683846 4:41332676-41332698 AACAGTGATCAGCCCAACTTGGG - Intergenic
974021894 4:56698915-56698937 AGCAGGGATGGGGCCAAATTGGG - Intergenic
974290620 4:59925488-59925510 AGCAGAGACCAAGCCATGCTGGG + Intergenic
974340642 4:60611111-60611133 AACAGAAACCAGGCCAAGTGTGG + Intergenic
976496557 4:85736914-85736936 AGCTGAGTTTAGGACAAGTTAGG - Intronic
978444005 4:108763241-108763263 AGCAAAGACGAGGCAAAGTTAGG - Intergenic
979090654 4:116478367-116478389 AGCAAAGTTGAGGCCAAGCTTGG - Intergenic
980840334 4:138252185-138252207 AGCAGAGATCATGCCAGCCTGGG - Intergenic
982386285 4:154807398-154807420 AGCAGAGATAAGGGCATGATAGG - Intronic
982450164 4:155543530-155543552 AGCTCAGTTCAGGCCAAGCTGGG - Intergenic
985380017 4:189383545-189383567 ACCAGAGAATAGGCCAAATTTGG + Intergenic
992872092 5:81017407-81017429 AGCATTGAGCAGGCCAAGTGTGG - Intronic
992984503 5:82213853-82213875 AGCAGAGATCAGAGAAAGATAGG - Intronic
993333444 5:86627865-86627887 AGCAGAGATGAGGGCAAGATGGG + Intergenic
994221885 5:97205761-97205783 AGCAGACATGAGGCAATGTTTGG - Intergenic
995543642 5:113208132-113208154 AGCAGAGATATAGCCAAGGTGGG + Intronic
999385270 5:151149772-151149794 AAAAGAGATCAGGCCAGGCTTGG - Intronic
1001690969 5:173632158-173632180 GGCAGAGATCAGGCTCAGTATGG + Intergenic
1005599563 6:27412306-27412328 AGCAGAGAGCTGGGCCAGTTGGG + Intergenic
1005978977 6:30821477-30821499 AGCACAGATCAGGCCAGGTGTGG - Intergenic
1006025127 6:31141880-31141902 GGCCGAGATGTGGCCAAGTTTGG - Intergenic
1006771080 6:36553448-36553470 AGCAGAGATCATTCTAAGCTGGG + Intergenic
1007034653 6:38662176-38662198 AGCTGAGTTCAGGCCAAAGTAGG + Intergenic
1008239687 6:49094345-49094367 AGCAGGCACCAGGCCATGTTTGG + Intergenic
1010044228 6:71421061-71421083 AGCCCAGATCAAGCCAAGTCCGG + Intergenic
1013368472 6:109451765-109451787 CTCAGAGGTCAGGCCATGTTGGG - Intronic
1018187631 6:161280764-161280786 CTCAGAGAACTGGCCAAGTTGGG - Intergenic
1019235517 6:170609146-170609168 AGCAGAGATGACTCCAAGCTGGG - Intergenic
1020761172 7:12269604-12269626 AGCAGAGTTGAGGCCAATTCTGG + Intergenic
1021072092 7:16253629-16253651 TGCAGAGATGAGTTCAAGTTAGG + Intronic
1024180151 7:46884103-46884125 AACACAAATCAGGCCAAGTGTGG - Intergenic
1024610478 7:51059865-51059887 AGCAAAAAACAGGCCACGTTGGG - Intronic
1027306100 7:76898857-76898879 AGCCGAGATCACGCCAAGGAAGG + Intergenic
1027737960 7:81959292-81959314 AGCAGACATCAGGCCCTTTTCGG + Exonic
1028254378 7:88575780-88575802 GGCACAGATCAGGCCATGTAAGG - Intergenic
1035383955 7:158458164-158458186 AGCGGAGCACAGGCCAAGCTCGG - Intronic
1035515350 8:228123-228145 AGCAGAGATGACTCCAAGCTGGG - Intergenic
1038079476 8:24117440-24117462 AAAAGATATCCGGCCAAGTTTGG - Intergenic
1038476776 8:27873995-27874017 AGCCGAGATCATGCCAGCTTGGG + Intronic
1040010589 8:42658077-42658099 AGCAGAGATCATGCCAGCCTGGG - Intergenic
1041169237 8:55124134-55124156 AGGAGAAATCAGGGGAAGTTAGG - Intronic
1043479995 8:80643227-80643249 AGCAGAGATGAGGCCAGGCACGG + Intronic
1044079180 8:87862991-87863013 AGGAGAGAAAAAGCCAAGTTTGG + Intergenic
1044881018 8:96722360-96722382 AGCAGAGAGCAGGCCAGATCTGG - Intronic
1045273281 8:100679955-100679977 AGCAGAGAGCAGGACAAGGTGGG + Intergenic
1045400345 8:101809833-101809855 AAAAGAGAGCAGGCCAAGTGCGG - Intronic
1046580779 8:116089840-116089862 AGCAGAGATAGATCCAAGTTTGG + Intergenic
1046750969 8:117926068-117926090 AGCAGATCTTAGGCCAAGTGCGG - Intronic
1050683170 9:8137797-8137819 AGCTGAGATCAGGGCAAGCAGGG + Intergenic
1051406700 9:16745249-16745271 AGAAGACCACAGGCCAAGTTTGG + Intronic
1051648136 9:19291411-19291433 AGCAGAGATAAGGCCAGGTGCGG + Intronic
1051784501 9:20727430-20727452 AGAAGAAATCAGGCCATTTTTGG + Intronic
1053398274 9:37795341-37795363 GGCACAGATCAGGGCATGTTTGG - Intronic
1055034845 9:71807358-71807380 AGCAAAAATCAGACCAAGCTGGG + Intronic
1057387748 9:94619581-94619603 AGCAGAGATAACGCCAGGTGTGG + Intronic
1059129717 9:111733813-111733835 AGCTGAGATCACGCCAACCTGGG + Intronic
1060197276 9:121631887-121631909 AGCAGGGAGCAGGGCAGGTTTGG + Intronic
1185581647 X:1214295-1214317 AGCAAAGCTCAGGCCAGGTGCGG - Intergenic
1186058963 X:5682866-5682888 TACAGAGAACAGGCCATGTTAGG + Intergenic
1186267430 X:7847507-7847529 ATCAGAAATCAGGCCAGGTGCGG + Intergenic
1188887386 X:35567506-35567528 AGCAAACTTCAGGCCCAGTTGGG + Intergenic
1190430375 X:50372843-50372865 AGTAGAGGTGAGGCCAGGTTAGG - Intronic
1190633144 X:52408605-52408627 AACAGAGTTCAGGCCAGGTGTGG - Intergenic
1190727165 X:53197163-53197185 AGGAGAGCTCAGCCCATGTTAGG - Intronic
1191868193 X:65722887-65722909 AGCGGAGATCAGGTCAGCTTAGG - Intronic
1196173101 X:112611503-112611525 CACAGAGATAAGGCCAAGTGAGG - Intergenic
1196799932 X:119533309-119533331 AGCAGAAACCAGGCCATGTAGGG - Intergenic
1197729441 X:129797441-129797463 CTCAGATATCAGGCCCAGTTTGG + Intergenic
1200951066 Y:8901160-8901182 AACAGAGAGGAGGCCAGGTTAGG - Intergenic
1202150584 Y:21840371-21840393 ATAAGAGTTCAGTCCAAGTTTGG - Intergenic