ID: 921228517

View in Genome Browser
Species Human (GRCh38)
Location 1:213045139-213045161
Sequence CCTGTAGGGTACTCGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921228510_921228517 7 Left 921228510 1:213045109-213045131 CCACTATGTTGGGGACCAGCCTC No data
Right 921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG No data
921228511_921228517 -8 Left 921228511 1:213045124-213045146 CCAGCCTCAACACCACCTGTAGG 0: 7
1: 20
2: 21
3: 29
4: 214
Right 921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921228517 Original CRISPR CCTGTAGGGTACTCGAAGTC CGG Intergenic
No off target data available for this crispr