ID: 921233214

View in Genome Browser
Species Human (GRCh38)
Location 1:213095251-213095273
Sequence CAGAGTAAAAAGAAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1685
Summary {0: 1, 1: 0, 2: 14, 3: 168, 4: 1502}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921233214 Original CRISPR CAGAGTAAAAAGAAAGAGAG AGG (reversed) Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900875293 1:5338258-5338280 GAGAGGAAAAAGAGAGAGAAGGG - Intergenic
901334644 1:8438917-8438939 CAAGGCAAAAAGAGAGAGAGAGG - Intronic
901336994 1:8458255-8458277 CAGAGAAAGATGATAGAGAGTGG + Intronic
901574036 1:10185550-10185572 AAAAGAAAAAAGAAAGAAAGGGG + Intergenic
901596530 1:10389855-10389877 AATAATAAAAAGAAAAAGAGTGG + Intergenic
901691570 1:10976768-10976790 CAGAAGAAAATGAAACAGAGTGG + Intronic
902142031 1:14365042-14365064 CACAAAAAAAAAAAAGAGAGGGG - Intergenic
902745018 1:18468042-18468064 CAGAGCAAAAAGAGAGAGGTAGG + Intergenic
902982361 1:20134135-20134157 GAGAGAAAGAAGAAAGAGAGAGG - Intergenic
903085637 1:20855530-20855552 AAGAATAAGAAGAAAGAGATTGG + Intronic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
904037390 1:27566160-27566182 CAAAGTCAGAAGAAAGACAGGGG + Intronic
904064902 1:27741882-27741904 CAAAAAAAAAAAAAAGAGAGAGG + Intronic
904073077 1:27816915-27816937 CAAAAAAAAAAGAAAGAGAAAGG + Intronic
904086144 1:27909712-27909734 AAGAGAAAAAAAAAAAAGAGCGG + Intronic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904413391 1:30339328-30339350 CAGAGTTTTAAGCAAGAGAGTGG + Intergenic
904481999 1:30799816-30799838 GAGGGAAGAAAGAAAGAGAGAGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904769410 1:32872460-32872482 CAAAGAGAAAAGAGAGAGAGAGG - Intronic
904849330 1:33445604-33445626 TGGAGTAAAAAGAAAGTAAGCGG + Intergenic
905062018 1:35148350-35148372 GAGAGAAAAAGGAAAGAGAGAGG - Intergenic
905076913 1:35280281-35280303 CAAAGAAAGAAGAGAGAGAGAGG - Intronic
905320427 1:37112690-37112712 CAGAGTACATAGAAAGAGGGAGG + Intergenic
905587226 1:39130052-39130074 CAGAGAAAAAAAAAATGGAGTGG - Intronic
905850991 1:41274818-41274840 CAGGGTGAGGAGAAAGAGAGGGG - Intergenic
905953553 1:41973535-41973557 CAATGGAAAGAGAAAGAGAGAGG + Intronic
906092501 1:43192935-43192957 AAAAATAAAAAGAAAGAAAGTGG + Intronic
906615416 1:47230014-47230036 AAGAGAAAGAAGAAAGAGAGAGG + Intronic
906631192 1:47369885-47369907 GAGAGAAAGAAGAAAGAAAGAGG - Intronic
906689473 1:47783081-47783103 GAGAGGAGAAAGAGAGAGAGAGG + Intronic
907093730 1:51754783-51754805 GAGAGTAAGAAAGAAGAGAGAGG - Intronic
907139189 1:52169435-52169457 AAGATGAAAAATAAAGAGAGAGG - Intronic
907177195 1:52535583-52535605 CACAGAAAGAAGAAAGAGAAGGG + Intronic
907680298 1:56556882-56556904 GAGAGAAGAAAGAAAAAGAGGGG + Intronic
907728795 1:57045708-57045730 AAAAGGAAAAAGAAAGAAAGTGG + Intronic
907793601 1:57692373-57692395 CAGAGAGGAAAGAGAGAGAGAGG + Intronic
907943307 1:59109490-59109512 CAGAGCAATAAGATAGAAAGAGG + Intergenic
908412723 1:63883402-63883424 AAAAATAAAAAGAGAGAGAGAGG - Intronic
908684471 1:66700068-66700090 CACAGTCAAAAGAGACAGAGTGG + Intronic
908854114 1:68405346-68405368 ATGAGTAAAAGGAAGGAGAGAGG + Intergenic
908865666 1:68546740-68546762 CAGAGGCAAGAGAAAGAGTGGGG + Intergenic
909081541 1:71118384-71118406 AAGAGAAAAAAGAAAGAGAAGGG + Intergenic
909351023 1:74653435-74653457 GAGAGGAGAAAGAGAGAGAGAGG + Intronic
909377791 1:74960038-74960060 CAGAAGCAAAAGAAAGAGGGAGG - Intergenic
909925921 1:81438010-81438032 CAGGCTGAAAATAAAGAGAGAGG - Intronic
910158705 1:84250480-84250502 CAATGTAAAAAAAATGAGAGAGG - Intergenic
910199552 1:84684960-84684982 CAGAGGAAAAAGGAATGGAGGGG + Intronic
910372771 1:86534967-86534989 CAGGCTAAGAAAAAAGAGAGAGG - Intergenic
910498535 1:87861667-87861689 AAAAGAAAAAAGAAAAAGAGTGG + Intergenic
910714128 1:90211970-90211992 AACATTAAAAAAAAAGAGAGAGG - Intergenic
910797246 1:91110062-91110084 CAGACTGAAAATAAAGAGATGGG + Intergenic
910819192 1:91328221-91328243 CAGACTAAGAAGAAAAAGAAGGG + Intronic
910912822 1:92255839-92255861 CACAATTAAAAGAAATAGAGAGG + Intronic
910989186 1:93037212-93037234 CAAAGAAAAAAAAAAAAGAGAGG + Intergenic
911358096 1:96846020-96846042 GAGAGAGAAAAGAAGGAGAGGGG - Intergenic
911401315 1:97378878-97378900 CAGAGGAAAAACACAGACAGAGG + Intronic
911430800 1:97784023-97784045 AACAGCAAAAAGAAAGTGAGAGG - Intronic
911432909 1:97814911-97814933 AAAAAAAAAAAGAAAGAGAGAGG + Intronic
911504924 1:98737072-98737094 AAGAGAAAAAAAAAAGCGAGGGG - Intronic
911601777 1:99855206-99855228 AAAAGAAAAAAGAAAAAGAGAGG + Intronic
911699316 1:100932960-100932982 AAAAGAAAAAAGAAAAAGAGTGG - Intronic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
911824148 1:102460209-102460231 CAGAGGAAAGAGATAGAGAAAGG - Intergenic
911946237 1:104113171-104113193 CTGAGCAAATAAAAAGAGAGTGG + Intergenic
912069275 1:105787668-105787690 GAGACTACAAAGAAAGAGAAAGG - Intergenic
912104770 1:106258430-106258452 CAGAACAGAAGGAAAGAGAGAGG - Intergenic
912143793 1:106765894-106765916 GAGAGGAAAAGGAAAAAGAGTGG + Intergenic
912222636 1:107695795-107695817 CAGTGTTAAATGAAAGAGAAAGG + Intronic
912233367 1:107821614-107821636 CACAGTAAAATGGAAGACAGAGG + Intronic
912702871 1:111891241-111891263 CAAAGAAAAAAGGAAGAGAATGG + Intronic
912980573 1:114368036-114368058 GAGAGCGAAAAGAGAGAGAGAGG - Intergenic
912980574 1:114368067-114368089 CAGAGAGGAGAGAAAGAGAGGGG - Intergenic
913012242 1:114695501-114695523 CACAGTAGAAAAGAAGAGAGAGG + Exonic
913336227 1:117710943-117710965 GAGAGCAAAAAGAAAGACTGAGG + Intergenic
913380480 1:118204830-118204852 CAGAGGAGAAAGGCAGAGAGAGG + Intergenic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
913670709 1:121095147-121095169 CAAAGGAAAAAGAAAAAGAAAGG - Intronic
914022474 1:143882589-143882611 CAAAGGAAAAAGAAAAAGAAAGG - Intergenic
914224381 1:145707989-145708011 AAGAGAAGAAAAAAAGAGAGGGG - Intronic
914347480 1:146812402-146812424 CAGAAGGAAAAGAGAGAGAGTGG + Intergenic
914413825 1:147458744-147458766 CACTGTAAATACAAAGAGAGGGG + Intergenic
914660958 1:149790531-149790553 CAAAGGAAAAAGAAAAAGAAAGG - Intronic
914972270 1:152318224-152318246 CAGGTTAAAAAGAAAGTGGGTGG - Intronic
915017155 1:152744681-152744703 AAGAGAAGAAAGAATGAGAGGGG - Intronic
915048048 1:153035634-153035656 CAGAGTGAGAAGAGACAGAGGGG - Intergenic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915155716 1:153874262-153874284 AAAAGAAAAAAAAAAGAGAGAGG + Intronic
915444819 1:155968673-155968695 CATAGTCAATAGAAAGAAAGGGG + Intronic
915562137 1:156693486-156693508 GAGAGGCAAAAAAAAGAGAGAGG - Intergenic
915748557 1:158183277-158183299 CCCAGTAAAAGGATAGAGAGAGG + Intronic
915770059 1:158411709-158411731 CAGGGAAAATAGAAATAGAGTGG + Intergenic
916008432 1:160682514-160682536 GAGAGGAAAAAGAAAAAGAAGGG + Intronic
916049287 1:161023863-161023885 CAAAGAAAAGAGAGAGAGAGAGG - Intronic
916095044 1:161341959-161341981 CACATTAACAAAAAAGAGAGTGG - Intronic
916161859 1:161924718-161924740 TAGAGTGAAAAGAAAGAGATAGG - Intronic
916260727 1:162839683-162839705 CAGGGAATAAAGAAAGAAAGAGG + Intronic
916286556 1:163111828-163111850 CAGAGTAAGAAAATAGAAAGTGG + Intronic
916424876 1:164670738-164670760 GAGAGGAAAAAGAAAGTGATAGG + Intronic
917029726 1:170676324-170676346 TAAAGAAAAAAAAAAGAGAGGGG - Intronic
917118627 1:171626376-171626398 CAGAGGAAAAGGAAACAGACTGG - Intergenic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917803392 1:178591507-178591529 GAGAGAAAAAAAAAATAGAGAGG + Intergenic
917947813 1:179994418-179994440 AAAAGAAAAAAGAAAGAGATAGG - Intronic
918012424 1:180600393-180600415 GAGGGTGAAAAGAGAGAGAGAGG + Intergenic
918430489 1:184454935-184454957 AAGAGAAAAGAGAAAGAAAGAGG + Intronic
918820086 1:189242307-189242329 AAGATTACAAAGACAGAGAGAGG + Intergenic
918845856 1:189611644-189611666 CAAAGAAAAAAAAAAGAGAGAGG - Intergenic
918849857 1:189673243-189673265 CAAAGGAAAAAGAAAAAGAGTGG - Intergenic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919115952 1:193280525-193280547 GAAAGAAAAAAGAGAGAGAGAGG - Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
919520311 1:198580413-198580435 CAGTTAAAAAAGACAGAGAGGGG - Intergenic
919578872 1:199346346-199346368 CAGAGGAAAAAAAAAGATAGAGG - Intergenic
919676385 1:200387718-200387740 CAGAGTAAGAAAAAGGAGATGGG + Intergenic
920415495 1:205796735-205796757 CAGAGTAAAAGGACAGATAAGGG - Intronic
920537967 1:206752674-206752696 GAAAGAAAGAAGAAAGAGAGAGG - Intergenic
920705246 1:208245561-208245583 CGGAGAAAAGAGAGAGAGAGAGG + Intergenic
920764090 1:208814750-208814772 AAGAATAACAAGAAAGAGAAGGG + Intergenic
920791603 1:209098094-209098116 CATAGTAAAAGGAAATACAGAGG - Intergenic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
920991430 1:210943650-210943672 CTGCTTAAAAAGAAGGAGAGAGG - Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921307961 1:213816012-213816034 CAGAGGAGAGAGAAAGAGACAGG + Intergenic
921508865 1:216007584-216007606 CAGAGCAAAAAGAAAGACTTTGG + Intronic
921608401 1:217181807-217181829 AAGAGCAAAAAGAAAGCAAGTGG + Intergenic
921661711 1:217810617-217810639 CAAAAAAAAAAGAAAGAAAGAGG + Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922103452 1:222492725-222492747 GAAAGAAAAAAAAAAGAGAGAGG + Intergenic
922365415 1:224858796-224858818 AAGAGTTACAAGAAAGAGAGAGG + Intergenic
922396625 1:225208583-225208605 TATAGTAAAAATAAATAGAGGGG + Intronic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922649951 1:227329293-227329315 AAAAGAAAAAAGAGAGAGAGAGG - Intergenic
922964987 1:229682039-229682061 AAGAGAAGAAAGAAGGAGAGAGG - Intergenic
923191392 1:231623897-231623919 CAGAAGAGAAAGAGAGAGAGAGG + Intronic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923514126 1:234680434-234680456 GAAAAGAAAAAGAAAGAGAGAGG + Intergenic
923619328 1:235565193-235565215 CAGAGGCTAAAGAAAGAGGGTGG + Intronic
923775218 1:236971834-236971856 CAAAGTAAAAAGACAGAGATTGG - Intergenic
923862788 1:237908356-237908378 TAGAGTGAAAATAAAGGGAGGGG + Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924176523 1:241396877-241396899 CAAAGAAAAAGGAAAGAGGGAGG - Intergenic
924323416 1:242871739-242871761 CAGAATAAAAAGGAAGTAAGTGG + Intergenic
924345614 1:243070232-243070254 GAAAGAAAAAAAAAAGAGAGAGG + Intergenic
924500971 1:244637598-244637620 CAAAGTAAAAAAAGAGAGATTGG - Intronic
1063020230 10:2119645-2119667 CATAGGCAAAAGAAAGAGAAAGG + Intergenic
1063360948 10:5457952-5457974 GTGAGTTAAAAGAAAAAGAGAGG + Exonic
1063522160 10:6750872-6750894 CACAGTAAAAAGAGAGAGAGAGG + Intergenic
1063555534 10:7075601-7075623 CAGGGGAAGAAGAAAGAAAGAGG + Intergenic
1063617121 10:7610042-7610064 AAGAAAAAAAAGAAAGGGAGGGG - Intronic
1063697841 10:8354966-8354988 AAAAGAAAAAAGAAAGAGAGAGG - Intergenic
1063701359 10:8388110-8388132 CAGATTGGAAAGAAAGAGAGTGG + Intergenic
1063910738 10:10827306-10827328 CAGAGTTAATAAAATGAGAGAGG - Intergenic
1064116768 10:12584818-12584840 CAAAGAAAAAAGAAAAAGAAAGG + Intronic
1064216510 10:13405137-13405159 AATAGGCAAAAGAAAGAGAGAGG - Intergenic
1064223146 10:13458855-13458877 GACAGTAAGAGGAAAGAGAGTGG - Intronic
1064336145 10:14444059-14444081 CAGATGACAAAAAAAGAGAGAGG + Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064968602 10:21040337-21040359 CAAAAAAAAAAGAAAGAAAGAGG + Intronic
1065041567 10:21703048-21703070 CAAAGTAAGAAGAAAGAGAAAGG - Intronic
1065082842 10:22144204-22144226 AAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1065134785 10:22656814-22656836 CAAAGAAAAAAGAAAGAGCCAGG + Intronic
1065184282 10:23157021-23157043 AAGAGAAAAAACAAAAAGAGAGG + Intergenic
1065211959 10:23412674-23412696 CAGATTTAAAAGAAAAATAGAGG + Intergenic
1065226254 10:23546476-23546498 CAAGTTAGAAAGAAAGAGAGAGG - Intergenic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1065438571 10:25726441-25726463 GAAAGAAAAAAGAAAGAGGGAGG - Intergenic
1065454003 10:25887664-25887686 CAGAGTAAAAAAGAACATAGAGG - Intergenic
1065466471 10:26029344-26029366 AAAAGTGAAAAGAATGAGAGAGG - Intronic
1065713130 10:28535881-28535903 CAGAGTAAAAAAAAAATGATAGG - Intronic
1065810399 10:29438058-29438080 GAGAGGAAAGAGAGAGAGAGAGG - Intergenic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066028585 10:31392686-31392708 TAGAATAAAAAGAAATATAGAGG + Intronic
1066179287 10:32944073-32944095 CAGGGGAAAAAGCAAAAGAGAGG + Intronic
1066347575 10:34603790-34603812 CACAGCAAAAAGAAAAAGATGGG + Intronic
1067428212 10:46225200-46225222 GAAAGAAAAAAGAAACAGAGAGG + Intergenic
1067798714 10:49341290-49341312 CACAGAAAAAAGAAAGAAAGAGG + Intergenic
1068233510 10:54202319-54202341 AAGAGAAAAAAAAAAGAGGGAGG + Intronic
1068325605 10:55482285-55482307 CACAGTTAAAAGACACAGAGTGG - Intronic
1068358424 10:55942758-55942780 CGGAGGAAAAACAAAGAGAGTGG + Intergenic
1068459185 10:57304447-57304469 CATAGAAAAGAGAAAGATAGGGG + Intergenic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1068631040 10:59297873-59297895 CAGAGTAAAACCATAGAGACAGG - Intronic
1068788857 10:61005931-61005953 CACAGTTAAAAGAACTAGAGAGG - Intergenic
1068995982 10:63204707-63204729 CATAGTCAGAAGACAGAGAGGGG - Intronic
1069020118 10:63476909-63476931 CAAACTAAAAGGAATGAGAGGGG + Intergenic
1069180017 10:65347285-65347307 CATAGCAAAAAGAAGGAAAGAGG + Intergenic
1069200365 10:65607648-65607670 AAGAGAAAAAAGAAAAAGAAAGG - Intergenic
1069276463 10:66596594-66596616 AAGAGAAAAGAGAAATAGAGTGG + Intronic
1069327971 10:67254305-67254327 AAGAGGAAGAAGTAAGAGAGAGG + Intronic
1069711220 10:70489918-70489940 AAGAAAAAAAAGAGAGAGAGAGG - Intronic
1069841554 10:71342661-71342683 CTGAGTAGAATGAAGGAGAGAGG - Intronic
1070006816 10:72432629-72432651 AAGAGTAAAGAGGAAAAGAGAGG + Intronic
1070014055 10:72507011-72507033 CAGAGGAATAAGAACGAAAGTGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1070572466 10:77650488-77650510 GAGAAGAAAAAGAAAGAGAAGGG + Intergenic
1070647427 10:78211437-78211459 GAGAGGAAGATGAAAGAGAGAGG - Intergenic
1070780318 10:79133767-79133789 CAAAGTTAACAGAAACAGAGGGG - Intronic
1070945403 10:80387104-80387126 CAGAGGAAAAAAAAAAAGTGTGG + Intergenic
1070979899 10:80635657-80635679 CAGAGGAAAGCGAAAGGGAGGGG + Intronic
1071098376 10:82006396-82006418 CAAAGTAAAAAGAAAGCCACAGG - Intronic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071186187 10:83048792-83048814 CAGAGTCAAAAGATAAAGAAAGG - Intergenic
1071189594 10:83083621-83083643 CAGGGTAAAAGGAAAGTCAGAGG - Intergenic
1071221399 10:83469575-83469597 CAGAAAAGAAAGAAAAAGAGGGG + Intergenic
1071254008 10:83850482-83850504 CAGAGGAAAAGGAAGGAGCGAGG - Intergenic
1071301325 10:84258037-84258059 CAGAGAACAAAGATGGAGAGGGG - Intronic
1071433909 10:85628835-85628857 CAGAGTGAATAGAATGGGAGTGG + Intronic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071745014 10:88407491-88407513 AATAGTACAAAGAAAGAGAAGGG + Intronic
1072008223 10:91277474-91277496 CAGGGTAAAAACAAACACAGAGG + Intronic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072276587 10:93829284-93829306 AAGGGGAAAGAGAAAGAGAGTGG - Intergenic
1072344744 10:94493084-94493106 CAGATTAAAAAAATAGAGATGGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072738481 10:97895533-97895555 CAGAGGAAAAAGATAGAAACAGG + Intronic
1073080749 10:100859106-100859128 CGGAGCAGAAAGAGAGAGAGTGG - Intergenic
1073174527 10:101545163-101545185 CAGAGGAAAAAGATACAGAATGG - Intronic
1073223189 10:101893665-101893687 GACAGGAAAAAAAAAGAGAGAGG + Intronic
1073740748 10:106403697-106403719 CAGAGCAAAGCGAAAGAAAGTGG + Intergenic
1073744128 10:106445948-106445970 CAGAGTAAAAGACAAGAGGGAGG - Intergenic
1073924245 10:108496669-108496691 CAGAGTACCAAGACTGAGAGAGG - Intergenic
1073963286 10:108958702-108958724 CAGACAAAAAAGAAAGAAAAGGG - Intergenic
1074128848 10:110554880-110554902 AAGAAGAAAAAGAAAAAGAGAGG + Intergenic
1074332411 10:112528783-112528805 CAGAGGAAATAGAAAGGAAGGGG + Intronic
1074335658 10:112572138-112572160 AAGATGAAAAAGAAAGATAGTGG + Intronic
1075125530 10:119696003-119696025 CACAATAAAAAGAATAAGAGAGG - Intergenic
1075157940 10:119995484-119995506 CAGTTTAAAAAGACAAAGAGGGG - Intergenic
1075204506 10:120435356-120435378 GAGAGAAAGAAGAAAGAAAGAGG + Intergenic
1075500326 10:122967242-122967264 AAGATTAAAAAAAAAGAGAAGGG + Intronic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075584448 10:123647036-123647058 AAAAGAAAAAAGAGAGAGAGAGG + Intergenic
1075618380 10:123907900-123907922 AAAAGAAAAAAGGAAGAGAGGGG + Intronic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1076220931 10:128732682-128732704 GAGAAAAAAAAGAAAGAAAGAGG + Intergenic
1077274985 11:1700581-1700603 CAGAGCAAAAAGGGAAAGAGGGG + Intergenic
1077314625 11:1913071-1913093 CAGAACAAAAAAATAGAGAGGGG - Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1077964454 11:7113809-7113831 CAAAGTAAATAGAAAGAAATGGG + Intergenic
1078202243 11:9194019-9194041 CTGAACAAAAAGAAAGACAGTGG + Intronic
1078596813 11:12694282-12694304 GAGAGAAAAAAGAGAGAGAGGGG + Intronic
1078601219 11:12732881-12732903 TAATGTAAAAAGAAAAAGAGAGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078776851 11:14401766-14401788 CTGGGTAACAAGAAAGAAAGAGG - Intergenic
1078817175 11:14837346-14837368 GAGAGGAAAAAGAAAGATTGGGG - Intronic
1078845059 11:15113095-15113117 GAGAGAGAAAAGAAAGAAAGAGG - Intronic
1078890973 11:15558961-15558983 GAAAGAAAGAAGAAAGAGAGAGG + Intergenic
1079404669 11:20134020-20134042 CAGCGAACAAAGAAAGGGAGAGG + Intergenic
1079482427 11:20895423-20895445 GAGAGTGGAAAGATAGAGAGCGG - Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079698029 11:23508028-23508050 CAAAAAAAAAAGAAAGAAAGAGG - Intergenic
1079913640 11:26341113-26341135 AAGAAAAGAAAGAAAGAGAGAGG - Intronic
1079915945 11:26368558-26368580 AAGAGAAAAAAGAAAGGGTGGGG + Intronic
1080016407 11:27511252-27511274 TAGAGCAAAAAGACAGAGGGAGG - Intergenic
1080028451 11:27636077-27636099 GAGAGGAAAAAGAAAGAAACCGG - Intergenic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1081156866 11:39703941-39703963 AAGAGGAGAGAGAAAGAGAGAGG - Intergenic
1081318889 11:41666284-41666306 CAGAGTAAAATGAAAATGTGAGG - Intergenic
1081797022 11:45827653-45827675 CAGAGTAAAAGGAAAAGAAGGGG - Intergenic
1081849911 11:46268223-46268245 CAATTTAAAAAGAAAGAGAGAGG + Intergenic
1082047744 11:47743905-47743927 CAGAGTTGAAAGATATAGAGGGG - Intronic
1082222421 11:49656055-49656077 CAGGCTTAAAAGAAACAGAGAGG - Intergenic
1082312566 11:50670810-50670832 CAGAATAAAAACAAAGGAAGTGG - Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083239108 11:61372784-61372806 CAAAAAAAAAAGAAAGAAAGAGG + Intergenic
1083493428 11:63030060-63030082 AAGAAAAAAAAGAAAGAGTGTGG + Intergenic
1083874804 11:65516416-65516438 GAGAGATAAAAGAGAGAGAGAGG + Intergenic
1083902036 11:65647867-65647889 CAAAAAAAAAAAAAAGAGAGAGG - Intronic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1085860457 11:80227095-80227117 TAGTGTGTAAAGAAAGAGAGAGG - Intergenic
1085960624 11:81457480-81457502 CAAAATAAATAGAAAGAGATAGG + Intergenic
1085972874 11:81614165-81614187 GATATTAAAAAAAAAGAGAGAGG + Intergenic
1085983253 11:81750519-81750541 CAGAGAAATAAGAAAGTGAAAGG + Intergenic
1085997571 11:81938460-81938482 AAGAAAAGAAAGAAAGAGAGAGG + Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086050625 11:82585685-82585707 GAGAGAGTAAAGAAAGAGAGAGG + Intergenic
1086146677 11:83560074-83560096 GAGAGTATAATGAAAGAGAGGGG + Intronic
1086361052 11:86059868-86059890 CATAAAAAAAAAAAAGAGAGAGG + Intronic
1086626623 11:88963149-88963171 CAGGCTTAAAAGAAACAGAGAGG + Intronic
1086693520 11:89816832-89816854 TAGAGTGACAAGAATGAGAGTGG - Intergenic
1086712629 11:90027737-90027759 TAGAGTGACAAGAATGAGAGTGG + Intergenic
1086819178 11:91413692-91413714 CAGTTAAAAAAGACAGAGAGGGG - Intergenic
1087280783 11:96207613-96207635 CACAGTCAAAAGAAAAACAGAGG + Intronic
1087365883 11:97218036-97218058 CACAGTAAAAAGAAAGAACCTGG - Intergenic
1087533378 11:99412019-99412041 CAGAATAAAAATAAAGAAATGGG + Intronic
1087637565 11:100719638-100719660 AAGAAAAAAAGGAAAGAGAGAGG - Intronic
1087654328 11:100904240-100904262 CAAAAAAAAAAAAAAGAGAGAGG - Intronic
1087675901 11:101161112-101161134 CAGAGTAATTGGAAAGAGAAAGG - Intergenic
1087679938 11:101209314-101209336 CAGAGCAAAAGGAAACAAAGAGG - Intergenic
1087741202 11:101889189-101889211 GAGAAGAGAAAGAAAGAGAGAGG + Intergenic
1087910994 11:103753244-103753266 CAGAGTAAAACAATAGGGAGTGG + Intergenic
1087965386 11:104406493-104406515 CAGACCAAAAATAAAGAGGGAGG + Intergenic
1088063829 11:105690906-105690928 CAGAGGAAGAAGAAAAAGATTGG - Intronic
1088170978 11:106996241-106996263 CATAGGAAAAAGAAGGGGAGGGG + Intronic
1088670663 11:112137267-112137289 GAAAGAAAAAAGAAAGAAAGAGG - Intronic
1089075164 11:115732727-115732749 GACATTAAAAAGAAAGAGAGAGG - Intergenic
1089357269 11:117862120-117862142 CAAAGGAAAGAGAAAGAAAGAGG + Intronic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1089927075 11:122269858-122269880 AAAAGAAAAAAGAAAGAGACAGG + Intergenic
1090305914 11:125690834-125690856 AAGAGTGAACAGAAAGGGAGTGG + Intergenic
1090327085 11:125898225-125898247 CAGTTTAAAAAGAAAAATAGTGG + Intronic
1090613734 11:128495717-128495739 CAAAGAAAAAAGAGAGAGAGGGG + Intronic
1090734714 11:129601559-129601581 CAGACTAATAAAGAAGAGAGAGG + Intergenic
1091215320 11:133897922-133897944 CAGAAAAGAAAGAGAGAGAGAGG + Intergenic
1091215637 11:133899699-133899721 CAGAGTCCACAGAAAGAGAGGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1091573467 12:1711719-1711741 CAGAGAGGAAAGAGAGAGAGAGG - Intronic
1091712813 12:2753541-2753563 CAGAAAAAAAAGGAAGAGAAGGG + Intergenic
1091889597 12:4042878-4042900 AAGAATAAAAAGAAAAAGAAAGG + Intergenic
1091921251 12:4306644-4306666 CAGAGCAAAAAGATAGGGAAAGG - Intergenic
1091995706 12:4992097-4992119 CAGAAAAAAAAAAAAGAGGGGGG - Intergenic
1092063676 12:5571689-5571711 GAGAGAGAGAAGAAAGAGAGAGG - Intronic
1092069580 12:5621816-5621838 AAGAGGAAGAAGAAAGAGAAGGG + Intronic
1092232626 12:6784901-6784923 AAAAGAAAAAAGGAAGAGAGAGG - Intergenic
1092451113 12:8603130-8603152 AAAAAAAAAAAGAAAGAGAGAGG - Exonic
1092565019 12:9655820-9655842 CAGAGTAATATGAAAGAAAGGGG + Intergenic
1092726997 12:11496665-11496687 AAGAAAAGAAAGAAAGAGAGAGG - Intronic
1092968464 12:13668936-13668958 AGAAGTAAAAAGGAAGAGAGGGG + Intronic
1093145992 12:15567503-15567525 CAGAGGGAAAAGAGAGAGAGAGG - Intronic
1093400129 12:18735739-18735761 TAGAGTAAGAAAAAAGAGAGAGG - Intronic
1093429691 12:19070728-19070750 AAAAGTAAAAAGAAAGAATGTGG - Intergenic
1093622971 12:21313995-21314017 CAGAAAAAAAAGAAAGAAATTGG + Intronic
1093626617 12:21356497-21356519 GAGAGAAAAAGGAAGGAGAGAGG + Intronic
1093931400 12:24958017-24958039 CAAAGAAAAAAGAAAGAGACTGG + Intergenic
1094047024 12:26178633-26178655 GAGAGCAAAAAGGAACAGAGTGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094227682 12:28064442-28064464 CAGAGCAAAGAAAAAAAGAGGGG - Intergenic
1094374657 12:29777090-29777112 AAAAATAAAAAGAGAGAGAGGGG - Intronic
1094460139 12:30687576-30687598 CAGAGTAATAAGGGAGAGAAGGG - Intronic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095313333 12:40727438-40727460 CAGATTAAAAAAAAAAAGAATGG + Intronic
1095420603 12:42020171-42020193 CAGAGAGAAAAAAAAGTGAGAGG + Intergenic
1095747291 12:45673985-45674007 GAGAGCAACAAGGAAGAGAGTGG - Intergenic
1095796610 12:46225902-46225924 CAGAATAAAAGGAAAGAAATGGG + Intronic
1096338832 12:50779543-50779565 CAAAAAAAAAAAAAAGAGAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096755755 12:53798040-53798062 CAGAGTTATAAAAAACAGAGTGG - Intergenic
1097025100 12:56049289-56049311 GAGAAAAAAAAGAAAGAAAGAGG + Intergenic
1097226784 12:57481549-57481571 GACTGTAAAAAGAAAGAGAGAGG - Intronic
1097473034 12:60019185-60019207 AAGAGAAGAAAGAAAGAAAGAGG - Intergenic
1097557951 12:61164083-61164105 CAGAGGAAAAAGGAACAGATGGG + Intergenic
1097680898 12:62647965-62647987 CAGAGAAGAAAAAAAGAGAAGGG + Exonic
1097734707 12:63168954-63168976 CAAAATAAAAAGAATGATAGAGG - Intergenic
1097945251 12:65360571-65360593 CAGAGGAAAAAGTAAGTGTGAGG - Intronic
1098042322 12:66364833-66364855 AAGAGTAAAGAAAAAAAGAGAGG - Intronic
1098478353 12:70932910-70932932 CAGAGGAAACACAAAAAGAGAGG - Intergenic
1098599521 12:72314265-72314287 AAAAGAAAAGAGAAAGAGAGAGG - Intronic
1098846446 12:75542411-75542433 AAGAGAGAAAAGAAAGAGTGGGG - Intergenic
1098977160 12:76914402-76914424 CAGAGTAAAAAGGATAAGTGAGG - Intergenic
1099110425 12:78553265-78553287 GAGAGTAAAAAGGAAGAGAGAGG - Intergenic
1099369145 12:81809100-81809122 AGGAGGAAAAAGAAAGAGGGGGG - Intergenic
1099953941 12:89334136-89334158 CAGAGAAACAAGAAAGGAAGTGG - Intergenic
1099990954 12:89720169-89720191 GAGAGTAAAGAGAAATGGAGAGG + Intergenic
1100133244 12:91521832-91521854 CAGAGTAGAAAGAGAAGGAGGGG + Intergenic
1100181393 12:92090407-92090429 CATAGAAAAAAGAAAGTCAGAGG + Intronic
1100190100 12:92181098-92181120 GAGAGAAAAAAAAAAGAGAGAGG + Intergenic
1100346985 12:93742290-93742312 CCGAGAAAAAAGAAAGAGCCGGG - Intronic
1100718680 12:97332179-97332201 AAAAATAAAAAGAGAGAGAGAGG + Intergenic
1100762038 12:97818870-97818892 AAGACTAAAAAGAAAGAAAGTGG - Intergenic
1100772123 12:97935027-97935049 AAGAGGAAACATAAAGAGAGAGG + Intergenic
1100871109 12:98911444-98911466 CTGAGTAAAAACATAGTGAGTGG + Intronic
1101010626 12:100445701-100445723 CAGAGGAAAAGAAAAGAGAAAGG + Intergenic
1101021987 12:100562367-100562389 GAGAATATAAAGAAAGAGAGTGG + Intronic
1101293800 12:103400114-103400136 GAGAGAGAGAAGAAAGAGAGAGG + Intronic
1101348138 12:103905207-103905229 GAAATAAAAAAGAAAGAGAGAGG + Intergenic
1101537059 12:105628243-105628265 ATGAGAAAAAAGAAAGAGGGGGG + Intergenic
1101648275 12:106651696-106651718 CAGGGTACAAAGAAATAGGGAGG + Intronic
1101839286 12:108316378-108316400 CAACGTAGACAGAAAGAGAGGGG + Intronic
1101898618 12:108774433-108774455 CAAAAGAAAAAGAAAGAGAAAGG + Intergenic
1101915221 12:108890622-108890644 GAGAAGAAAAAAAAAGAGAGAGG - Intronic
1102012772 12:109628781-109628803 CAGAGAGAAAAGAAAGAAAAAGG - Intergenic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102194725 12:111016900-111016922 CAGAGGTAAAAGAGAGAGGGAGG - Intergenic
1102249496 12:111376581-111376603 CTGTTTAAAAAGAGAGAGAGAGG + Intergenic
1102393946 12:112572605-112572627 GAAAGAAAAAAGAGAGAGAGAGG - Intronic
1102407299 12:112684960-112684982 CAGAGCAAAAAGAAAGAAAAGGG - Intronic
1102420371 12:112798738-112798760 CAGGGAAAAAGGAGAGAGAGGGG - Intronic
1102558636 12:113746521-113746543 GAGAATCAAATGAAAGAGAGAGG - Intergenic
1102572387 12:113834966-113834988 CAGAGGGAAAGGAAAGAAAGAGG - Intronic
1102648389 12:114418652-114418674 CAGAGTGATAAGATGGAGAGAGG - Intergenic
1102997948 12:117364122-117364144 CAGAGTAAGAGAAGAGAGAGAGG + Intronic
1103168252 12:118789596-118789618 AAGAAAAAAAAGAAAGAGAAAGG - Intergenic
1103313819 12:120035033-120035055 CAGAGTAAGAATAAAAGGAGAGG + Intronic
1103475328 12:121213860-121213882 AAAAGTAAAAAGAAATAGAAAGG - Intronic
1104073262 12:125366073-125366095 CAGCTTAAAAAAAAAGAAAGTGG - Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104271718 12:127288270-127288292 CAGAGAAGAAAGAAAGAGCCTGG + Intergenic
1104379636 12:128295862-128295884 CAGAGCAGAGAGAAAGACAGAGG - Intronic
1104412874 12:128573898-128573920 CAAAAAAAAAAAAAAGAGAGTGG + Intronic
1104594275 12:130109839-130109861 CAGAGCCCACAGAAAGAGAGTGG - Intergenic
1104655315 12:130570094-130570116 CAGAGAGAGAGGAAAGAGAGTGG - Intronic
1105249525 13:18685500-18685522 CAGAGGACAAAGGAAGAGAGTGG - Intergenic
1105592914 13:21811121-21811143 CAGAGTGGAGAGAAAGAAAGGGG + Intergenic
1105806625 13:23955265-23955287 CAGAGTAGGAAGAAAAAGACAGG + Intergenic
1105845719 13:24292054-24292076 CAGATAATAAAGACAGAGAGAGG - Intronic
1105870846 13:24505155-24505177 CAGAGGAGAAAGAAAGAGAGAGG + Intronic
1105991821 13:25629719-25629741 CACAGTAAAAAGGCAGAGGGTGG - Intronic
1106082366 13:26511051-26511073 CAGAGTGAAAACACAGGGAGAGG + Intergenic
1106400517 13:29425453-29425475 CAAAGAAAAAAGAAAGACAAGGG + Intronic
1106486149 13:30174398-30174420 CAGAGTGAAAAAAAAGGAAGTGG + Intergenic
1106519187 13:30482251-30482273 AAGAGAAAAGAGAAAGGGAGAGG - Intronic
1106525591 13:30538814-30538836 AAAAGAAAAAAGAAAGAAAGGGG - Intronic
1106609920 13:31268875-31268897 CAGAGAAAGAAAAAAGAAAGAGG - Intronic
1106859018 13:33884853-33884875 CAGAGGAAAGAAAAAGAGAAAGG + Intronic
1106883346 13:34156192-34156214 CAGAGCTAGAAGAAAGAGACCGG - Intergenic
1106937740 13:34742615-34742637 CAGAGTAGACAGACACAGAGTGG - Intergenic
1107494266 13:40909643-40909665 TAAAGAAAAAAGAAAGAGAAAGG + Intergenic
1108434760 13:50390848-50390870 CAGAGCCAGAAGAAAGTGAGAGG + Intronic
1108605770 13:52037077-52037099 GAAAGTCAAGAGAAAGAGAGGGG - Intronic
1108692675 13:52873478-52873500 CACAGTGAAAAGGAATAGAGGGG - Intergenic
1108711317 13:53035158-53035180 AAGGGTTAAAGGAAAGAGAGAGG - Intronic
1108753647 13:53474340-53474362 TAAATTTAAAAGAAAGAGAGAGG - Intergenic
1108819884 13:54335747-54335769 CAGAATAAAAAAAAAAAAAGTGG - Intergenic
1108851128 13:54730671-54730693 TAGAATAAAAAGACAGAGGGAGG - Intergenic
1108896574 13:55335637-55335659 CAGAAGCAAGAGAAAGAGAGTGG - Intergenic
1109086780 13:57983827-57983849 CAAAAAAAAAAAAAAGAGAGAGG + Intergenic
1109110407 13:58311410-58311432 TATAGTCAAGAGAAAGAGAGAGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109664892 13:65521257-65521279 CAGAGAAAAGTGAAAGACAGAGG - Intergenic
1110159945 13:72363818-72363840 CAGAGTAAAGAGAGAGAAACTGG - Intergenic
1110273521 13:73617327-73617349 AAGAAAAAAAAGAAAGAAAGTGG - Intergenic
1110335306 13:74323295-74323317 AACACTAAAAAGAAGGAGAGAGG - Intergenic
1110531054 13:76598719-76598741 CAGTTTTAAAAGAAAGAGATGGG - Intergenic
1110578563 13:77090964-77090986 TAGAGAAATAAGAAAGAGAAGGG - Intronic
1110821922 13:79926394-79926416 GAGAGCAAGAAGAAACAGAGTGG - Intergenic
1110986090 13:81971100-81971122 CAGATAAATAAGAAAGATAGGGG + Intergenic
1111324881 13:86681427-86681449 GAGAGGAAGAAGAGAGAGAGAGG + Intergenic
1111891520 13:94088523-94088545 TATATTAAAAAGAAAAAGAGAGG + Intronic
1111948890 13:94694072-94694094 CACAGCAAAGAGAAAGAGAGAGG + Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112257922 13:97851631-97851653 CAGAGAAGAAAGTCAGAGAGAGG + Intergenic
1112414638 13:99194160-99194182 AAGATAAAAAAGAAAGAAAGTGG - Intergenic
1112628558 13:101135316-101135338 CAGAGACAAAAGAAGGTGAGTGG + Intronic
1112635991 13:101218710-101218732 CAGGAGGAAAAGAAAGAGAGAGG - Intronic
1112691155 13:101896142-101896164 AATAGTAAAAAGAAAGGGAAGGG - Intronic
1112744830 13:102514819-102514841 AGGAGGAAGAAGAAAGAGAGAGG + Intergenic
1112843920 13:103614392-103614414 AAGAGAAAAAAGAAACATAGGGG + Intergenic
1112883127 13:104133971-104133993 CAGAGTGTAAAGAAGGAGATGGG + Intergenic
1112915142 13:104539210-104539232 CAGAGCAGAAGGAAAGAGAGTGG + Intergenic
1112917856 13:104573125-104573147 TAAAGGAAAGAGAAAGAGAGAGG + Intergenic
1113011555 13:105773351-105773373 GAGAGTATAAACAAAGATAGTGG - Intergenic
1113035120 13:106039703-106039725 CAGAGGGATAAGAAAGAGAGTGG - Intergenic
1113075207 13:106461337-106461359 CAGAGGACAAAGAAAGAGCTGGG + Intergenic
1113625441 13:111792921-111792943 AAGAGAAGAAAGAAAGACAGAGG - Intergenic
1114281273 14:21194275-21194297 CTTAGAAAAGAGAAAGAGAGTGG + Intergenic
1114301964 14:21386196-21386218 GATAATAAAAAGAAAGAAAGGGG + Intronic
1114335982 14:21690319-21690341 CAGATCAAAATGAAAGAAAGAGG + Intergenic
1114370415 14:22081118-22081140 GAAGGTAAAAAGAATGAGAGGGG - Intergenic
1114428615 14:22641300-22641322 CAGAGAGGAAAGAGAGAGAGAGG + Intergenic
1114452620 14:22837055-22837077 AAGAGGAAAAAGAAAGGGAGGGG - Intronic
1114642084 14:24230605-24230627 AAAAAAAAAAAGAAAGAGAGAGG - Intronic
1114673426 14:24426715-24426737 CAGCGGGATAAGAAAGAGAGAGG + Exonic
1114822471 14:26038208-26038230 CAGAGAAAATGGAAAGAGAAAGG - Intergenic
1114898580 14:27026488-27026510 CAGAGGAAGGAGAGAGAGAGCGG - Intergenic
1114902360 14:27079311-27079333 TAGAGAAATAAGAAAGAGATGGG - Intergenic
1115192827 14:30764672-30764694 GAGAATAAAAACAAAGAGAATGG + Intergenic
1115470908 14:33767474-33767496 CAGAGGAAAAAAAAAGAAAAGGG + Intronic
1116051191 14:39805190-39805212 CAGATTAAAAAGGAATAGAATGG - Intergenic
1116206442 14:41873379-41873401 CAGAAGAGAGAGAAAGAGAGAGG + Intronic
1116220239 14:42075931-42075953 CAGAGTAAGAGGAGAGACAGTGG + Intergenic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116267034 14:42705538-42705560 CAGAGTTTAGAGAAAAAGAGAGG + Intergenic
1116880081 14:50158728-50158750 CAAAGTAAAAAGAAAAAGGGAGG - Intronic
1117377047 14:55126591-55126613 CAGAGAGAAAGGAAAAAGAGAGG - Intronic
1117389245 14:55247442-55247464 GAGATTAAAGAGAGAGAGAGAGG + Intergenic
1117456152 14:55898912-55898934 CAGAGGAAAGAGTAAGGGAGGGG - Intergenic
1117607297 14:57442801-57442823 CAAAATAGAAAGAAACAGAGAGG - Intergenic
1117698772 14:58393161-58393183 GTGATTTAAAAGAAAGAGAGTGG + Intergenic
1117715487 14:58575691-58575713 CAGAGGGAAATGGAAGAGAGAGG - Intergenic
1117759222 14:59009253-59009275 CAGAGGTAAGAAAAAGAGAGAGG + Intergenic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1117930679 14:60838038-60838060 CAGAGGGAAAAAAAAGTGAGAGG - Intronic
1117987691 14:61404675-61404697 CAGAGTAAGAGGACAGAGATGGG + Intronic
1118088448 14:62445511-62445533 CAGAGTAATAAGAAAAAGGAGGG - Intergenic
1118139423 14:63064324-63064346 GAGAGTGAGAAGAAAGAGAAGGG + Intronic
1118169402 14:63372083-63372105 GAGAGAAAAAAAAAAGAGAAAGG + Exonic
1118180162 14:63484265-63484287 CAGACTAAAAAGCCTGAGAGGGG + Intronic
1118338037 14:64871359-64871381 AAGAGTAGAAAAAAAGAGACTGG + Intronic
1118487523 14:66227910-66227932 TAGAGGAAAAAGAAAAAGAAGGG + Intergenic
1118841445 14:69516202-69516224 AGGAGGAAAAAGAAAGAGAACGG - Intronic
1118867239 14:69713130-69713152 CAGAGTAACAAGATAGAAAAAGG - Exonic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119188043 14:72658596-72658618 CAGAGGAAAAAGAAATGGATAGG + Intronic
1119440765 14:74627154-74627176 CAAAAAAAAAAAAAAGAGAGAGG + Intergenic
1119523335 14:75302422-75302444 CAGAGTAAAGGGAAAGGGAGTGG - Intergenic
1119945416 14:78688304-78688326 CAAAGGAAATAAAAAGAGAGAGG + Intronic
1120182021 14:81353644-81353666 CAGAGGAAAAAGAAAATCAGAGG + Intronic
1120313647 14:82863618-82863640 TACAGTAAAATGAAACAGAGAGG - Intergenic
1120395929 14:83966849-83966871 GAGAGGGAAAAGAAAGAAAGGGG - Intergenic
1120584251 14:86291373-86291395 CAGAGGAGAGAGAGAGAGAGAGG - Intergenic
1120771990 14:88389222-88389244 AAAAGAAAAAAGAAAGAGAAAGG - Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121372526 14:93373403-93373425 CTGAGAAAAAAAAAAGAGAGAGG + Intronic
1121475831 14:94201571-94201593 CAGTTTAAAAAGACAAAGAGGGG - Intronic
1121502522 14:94449389-94449411 AAGAATAGAAAGAAAGAAAGAGG - Intronic
1121620339 14:95343010-95343032 CAGATCAAAAAGAAAAAGAATGG + Intergenic
1121990630 14:98553432-98553454 GAGAATAAAAAGAAAAAGTGGGG - Intergenic
1122391373 14:101388430-101388452 CATAGTAAACTGAAACAGAGGGG - Intergenic
1122547943 14:102535057-102535079 CAGAGAAAAAAAAAAGGGGGGGG + Intergenic
1122749976 14:103925985-103926007 CAGAGTTAAAAGAAACAGCTTGG - Intronic
1122868379 14:104621265-104621287 GAGAAAAGAAAGAAAGAGAGAGG + Intergenic
1123116630 14:105897775-105897797 CAGGGTAAACAGAAAATGAGAGG - Intergenic
1124029697 15:25999280-25999302 CCTAGCAAAAAGAGAGAGAGAGG - Intergenic
1124035891 15:26053357-26053379 AAAAGGAAAAAGAAAGAGGGAGG + Intergenic
1124121105 15:26889365-26889387 CAGAAAAAAAAAAAAGACAGTGG - Intronic
1124643999 15:31422145-31422167 AAAAGAAAAAAGAAATAGAGTGG + Intronic
1124732107 15:32207820-32207842 GAGAGAGAAAAAAAAGAGAGAGG + Intergenic
1125805822 15:42492702-42492724 GAGAGAAAAAAGAAAGGAAGCGG + Intronic
1125953457 15:43773697-43773719 AAAAGAAAAAAAAAAGAGAGAGG + Intronic
1125985763 15:44050227-44050249 CAGTGTGCAAAAAAAGAGAGTGG + Intronic
1126051978 15:44694480-44694502 AAGAGGCAAAAGAAAGAGAAAGG - Intronic
1126059784 15:44769328-44769350 CAGCATAAAAAGAAAAAGAAAGG + Intergenic
1126849838 15:52790220-52790242 CAGAATTTTAAGAAAGAGAGGGG - Intronic
1127017671 15:54707454-54707476 AAAAGTAAAAGGAAAGAGGGCGG - Intergenic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127479607 15:59366278-59366300 GAGAAAAAAAAGAAAGAGACAGG - Intronic
1127546406 15:59997377-59997399 AAGAGAGAAAAGAAAGAAAGCGG - Intergenic
1127576876 15:60300170-60300192 CAAAGAAGAAAGAAAAAGAGGGG + Intergenic
1127701075 15:61501805-61501827 CTGAGTAAAAACAAAGAGAAAGG + Intergenic
1128321005 15:66694301-66694323 TATAGCAAAAAGAAAGAGATTGG - Intergenic
1128396060 15:67227322-67227344 CAAAGTAAAAAAAAAAATAGAGG - Intronic
1128694790 15:69753009-69753031 GAATGTAAAAAGAAAGAGTGGGG + Intergenic
1129520390 15:76182334-76182356 AAGGGTTAAAAAAAAGAGAGAGG + Intronic
1129610381 15:77049942-77049964 CAGAGTACAAACAAAGGCAGGGG + Intronic
1129812575 15:78522887-78522909 AAAAGAAAAAAGAGAGAGAGAGG + Intronic
1129943821 15:79522101-79522123 CACCTTTAAAAGAAAGAGAGTGG + Intergenic
1130110637 15:80960958-80960980 CACAGTAAAAAGGGAGACAGTGG - Intronic
1130663097 15:85846394-85846416 CAGAGGAACAAAAAAGAGATAGG + Intergenic
1130680866 15:85995436-85995458 TAGAGTAGAAGGAGAGAGAGGGG + Intergenic
1130790739 15:87153276-87153298 TAAAGTAAAAAGAAAGATCGAGG - Intergenic
1130819206 15:87476102-87476124 TAGAGTTACAAGAAATAGAGAGG - Intergenic
1131504630 15:93005616-93005638 CAGAGAAAGAAGTCAGAGAGAGG - Intronic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1131610764 15:93960137-93960159 CAGAGGAAAAAGAAAGACATGGG - Intergenic
1131905643 15:97139108-97139130 CAGAGAGAAAAGAAAGAGGTAGG + Intergenic
1132000320 15:98172930-98172952 AAGAGTAAAAACAGAGAGGGTGG - Intergenic
1132005481 15:98222718-98222740 TAAAGAAAAAAGAAAGACAGAGG - Intergenic
1132800993 16:1753161-1753183 CAGAGTAAAAATGCTGAGAGAGG - Intronic
1133115981 16:3578277-3578299 CAGAGAGAAAAGAAAGCAAGAGG - Intergenic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133506428 16:6417005-6417027 AAAAATAAAAAGAAAGAAAGAGG - Intronic
1133688249 16:8187835-8187857 AAGAAGAGAAAGAAAGAGAGAGG + Intergenic
1133850046 16:9494855-9494877 AAGAGACAAAAGAAGGAGAGTGG + Intergenic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1134001677 16:10787729-10787751 AATAGGCAAAAGAAAGAGAGAGG - Intronic
1134245278 16:12535064-12535086 CACAGTCAAGAAAAAGAGAGAGG + Intronic
1134247853 16:12553277-12553299 CAGAGTAAGAGGAAAATGAGTGG + Intronic
1134264398 16:12680989-12681011 AACATTAAAAAGAAAGAAAGAGG - Intronic
1134324442 16:13194070-13194092 GAGAAGGAAAAGAAAGAGAGAGG - Intronic
1134639001 16:15814183-15814205 CAGTTTAAAAAGAACTAGAGAGG + Intronic
1134760464 16:16709888-16709910 CAAAAAAGAAAGAAAGAGAGAGG - Intergenic
1134784035 16:16924718-16924740 CAGCTAAAAAAGAAATAGAGGGG - Intergenic
1134985595 16:18649285-18649307 CAAAAAAGAAAGAAAGAGAGAGG + Intergenic
1135062390 16:19282020-19282042 GAGAGATAAAAGAGAGAGAGAGG + Intergenic
1135175211 16:20221746-20221768 CAGAGGGAAATGACAGAGAGAGG - Intergenic
1135275581 16:21109727-21109749 AAGAAAAAAAAAAAAGAGAGAGG - Intronic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1135536818 16:23301374-23301396 GAAAGAAAGAAGAAAGAGAGAGG + Intronic
1135551240 16:23399788-23399810 CAAGGGAAAAAGAAAGAGAGAGG + Intronic
1135652680 16:24219909-24219931 CAGCGTAAGAAGAAAGACACAGG - Exonic
1135713043 16:24734174-24734196 CAAAGCAAAAAGAGAGAGAAAGG + Intronic
1135857771 16:26027970-26027992 AAGATTAAAAAGAATAAGAGAGG + Intronic
1136101854 16:28002628-28002650 CAAATTAAAAAGAAAAAAAGAGG + Intronic
1136589022 16:31206075-31206097 GAGAGAAAGAAGAAAGAAAGAGG - Intergenic
1136674399 16:31889159-31889181 CAAGGGAAAAAAAAAGAGAGAGG - Intronic
1137307104 16:47212809-47212831 CTGACCAAAAAAAAAGAGAGAGG - Intronic
1137822348 16:51458146-51458168 AAGAAAAAAAAGAAAGAAAGAGG - Intergenic
1137853713 16:51772499-51772521 CATAGCAAGAAGAAAGGGAGAGG + Intergenic
1137882721 16:52069066-52069088 CAGAGAAAAAGGAGAAAGAGTGG - Intronic
1137941182 16:52687134-52687156 CACATTAGAGAGAAAGAGAGAGG - Intergenic
1138003006 16:53301747-53301769 AAGAAAAAAAAGAAAGAGAGAGG - Intronic
1138179653 16:54932935-54932957 GGGAGTAAAAAGGAAAAGAGAGG + Intronic
1138609397 16:58110802-58110824 CAGAGGAAGAAGGAAGCGAGGGG - Intergenic
1138628488 16:58273276-58273298 GAGAGAGAAAAGAAAGAGAAAGG - Intronic
1138989174 16:62370430-62370452 CAGAGAATAAATAAAAAGAGAGG - Intergenic
1139239514 16:65376611-65376633 CAGAGTCTAAAGAAAGAGGGAGG + Intergenic
1139259798 16:65580414-65580436 CAGAGGAGAAAGAAAGAGTGTGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139402481 16:66694041-66694063 AAGAGTGAGAAGAAAGAGAGAGG + Intronic
1139478957 16:67217782-67217804 GAGAGTAAAAAGAGACATAGAGG - Intronic
1139518046 16:67463536-67463558 GAAAGAAAAAAGAAAGAGGGAGG + Intronic
1139633388 16:68244212-68244234 AAAAGAAAAAAGAAAGAGGGAGG + Intergenic
1139640850 16:68290451-68290473 CAGAGTAGAGGGCAAGAGAGAGG - Exonic
1139708736 16:68760558-68760580 CAGATTAAAGAGAAAGAATGGGG - Intronic
1139986506 16:70902842-70902864 CAGAAGGAAAAGAGAGAGAGTGG - Intronic
1140903562 16:79392006-79392028 CAGAGTAAGGAAAGAGAGAGAGG + Intergenic
1141175854 16:81718726-81718748 CAGAGTGAAAGGACAGAGACAGG + Intergenic
1141576559 16:84967586-84967608 AAAAGAAAAAAGAAAGGGAGGGG + Intergenic
1142112012 16:88337995-88338017 CAGAGGAAAAATAGAGAAAGTGG - Intergenic
1143332473 17:6147921-6147943 CAGAATAAAAAGAAATGGGGAGG - Intergenic
1143450339 17:7032567-7032589 CACAGAGAAAAGAAACAGAGTGG - Intergenic
1143701144 17:8661069-8661091 CAGAAAAGAAAGAGAGAGAGAGG - Intergenic
1143711492 17:8739104-8739126 AAGAAAAAAGAGAAAGAGAGGGG + Intronic
1143754010 17:9053293-9053315 CAGTGTTGGAAGAAAGAGAGCGG - Intronic
1143794834 17:9328058-9328080 AAGAAAAGAAAGAAAGAGAGAGG - Intronic
1144865930 17:18335717-18335739 GAGCCTAAAAAGAAAAAGAGGGG - Intronic
1145848461 17:28066147-28066169 CAGGGTAAGAGGAAAGGGAGAGG - Intronic
1145992704 17:29088676-29088698 CAGAGCAGATAGCAAGAGAGAGG - Intronic
1146090395 17:29871851-29871873 CAGAATTTAAAGAAATAGAGAGG + Intronic
1146235610 17:31158121-31158143 AAGAGTAAAAAGTAGAAGAGAGG - Intronic
1146588010 17:34099592-34099614 AAGAGAAAAAAGAGAGAAAGAGG + Intronic
1146599426 17:34201705-34201727 CAAAGTGCATAGAAAGAGAGTGG + Intergenic
1146831738 17:36075571-36075593 CATAGGAAAAGGAAAGAAAGTGG + Intergenic
1147014185 17:37477394-37477416 CAGATTTAAAATAAAGAGAAAGG + Exonic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148708868 17:49661618-49661640 CATAGTAGAAAGACAGGGAGGGG - Intronic
1148713632 17:49699983-49700005 CAGGGTGAAAAAAAAGACAGGGG + Intergenic
1149101890 17:52917143-52917165 CAGATTAAAAAAAAATAGAAAGG - Intergenic
1149117866 17:53119816-53119838 AAGAAGAAAAAGAAAGAAAGAGG + Intergenic
1149168056 17:53777809-53777831 CATATTAAAGAGAAACAGAGTGG + Intergenic
1149399405 17:56279587-56279609 AAGAGAAAAAACAGAGAGAGGGG - Intronic
1149435935 17:56633563-56633585 AGGAGTCAAAAGAAAAAGAGAGG + Intergenic
1149478669 17:56984465-56984487 CAGAGAAAAAAGAAACTAAGAGG - Intronic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1150062366 17:62079600-62079622 TAAAGGCAAAAGAAAGAGAGAGG - Intergenic
1150181373 17:63124520-63124542 AAGAGGAGAAAGAAAGAGAGAGG + Intronic
1150194649 17:63283998-63284020 TTGAGTAGAAACAAAGAGAGCGG + Intronic
1150315922 17:64168792-64168814 AAGAGCAAAAAGGAATAGAGAGG + Intronic
1150464995 17:65385320-65385342 CAAAAAAAAAAGAGAGAGAGAGG - Intergenic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150641075 17:66949900-66949922 CAGAATAAAAACACAGAAAGAGG - Intergenic
1150689598 17:67353319-67353341 CTGTCTCAAAAGAAAGAGAGAGG - Intronic
1150753099 17:67884414-67884436 CAGAAAAAAAAAAAAGGGAGGGG - Intronic
1150982432 17:70157438-70157460 CAGAGGAAAAGGAAAGACAGAGG + Intergenic
1151166786 17:72210749-72210771 CAGAGCCAATAGGAAGAGAGAGG + Intergenic
1151528571 17:74688631-74688653 GAGTGTAAAAAAAAAGAGAACGG + Intronic
1151918465 17:77136344-77136366 GAAAGAAAAAAGAAAGAGAAAGG - Intronic
1152260711 17:79265399-79265421 GAAAGGAAAAAGCAAGAGAGAGG - Intronic
1152369096 17:79874351-79874373 CCAAGTAAAAAGCAAGAGATTGG - Intergenic
1152373186 17:79903235-79903257 GAAAGAAAAAGGAAAGAGAGAGG - Intergenic
1152964477 18:101834-101856 CAGATTGCAAAAAAAGAGAGAGG + Intergenic
1153789000 18:8560820-8560842 GAGGGAAAAGAGAAAGAGAGCGG - Intergenic
1153972636 18:10240312-10240334 CAGAGGAGAAAAGAAGAGAGAGG + Intergenic
1154123497 18:11670266-11670288 GAGAGTAAGAAGAAAAAGACGGG - Intergenic
1154439306 18:14373385-14373407 CAGAGGACAAAGGAAGAGAGTGG + Intergenic
1155058260 18:22204432-22204454 GAAAGAAGAAAGAAAGAGAGGGG - Intergenic
1155180538 18:23341727-23341749 AATAGGAAAAAGAGAGAGAGAGG + Intronic
1155346043 18:24858028-24858050 AAGAGAAAAAAAAAAGATAGCGG + Intergenic
1155386466 18:25283168-25283190 CTGAGAAAAAAGATAGTGAGTGG - Intronic
1155444574 18:25897719-25897741 CAGATAAAAAAGAATGAAAGAGG - Intergenic
1155525927 18:26716135-26716157 CAGAGTCAAGAGATAGAGAAAGG + Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155648299 18:28108864-28108886 CAGAGTAGGAGGGAAGAGAGGGG - Intronic
1155705607 18:28807020-28807042 TATAGTAAAAAGAGAGAGAAAGG + Intergenic
1155729269 18:29132171-29132193 CAGAGTCAAGAGAATGAGTGAGG - Intergenic
1155903679 18:31423367-31423389 CCGAGTTAAAAGTAAGAGAGAGG + Intergenic
1156272618 18:35550808-35550830 TAGAGTAAAAAGACAAAGATTGG - Intergenic
1156286267 18:35699156-35699178 CAGAGTAGAGAGAATTAGAGGGG - Intronic
1156558954 18:38099653-38099675 AAGAGGAAAAGGAAAGAGTGAGG + Intergenic
1156639829 18:39078894-39078916 CATAGTAAGAAAAAAGAGTGAGG + Intergenic
1156781459 18:40855514-40855536 AAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1156914920 18:42454402-42454424 TAAATTAAAAAAAAAGAGAGAGG + Intergenic
1157064946 18:44338166-44338188 CAGACTGAAAATAAAGAGATGGG - Intergenic
1157355685 18:46931714-46931736 GAGAGAAAAAAGAGAGAGAGAGG + Intronic
1157442525 18:47721686-47721708 CAGAATAAAAGGAAGGAAAGAGG + Intergenic
1157672430 18:49541640-49541662 AAAAGAAAAAAGAGAGAGAGAGG - Intergenic
1157894513 18:51452255-51452277 TAGAGCAAAAAGACAGAGAAAGG - Intergenic
1157929494 18:51805630-51805652 AAGAGTGAAATAAAAGAGAGAGG - Intergenic
1157990090 18:52484698-52484720 AAGAGCAAAAAGAAATTGAGTGG + Intronic
1158016626 18:52791419-52791441 CAGAGTGGAAAGGAAGACAGTGG + Intronic
1158069096 18:53449641-53449663 CTGAGTGACAAGAACGAGAGAGG - Intronic
1158538931 18:58335081-58335103 GAAAGTACAAAGAAAGAGGGAGG - Intronic
1158673466 18:59497828-59497850 CAGGTTAAAAAGACAGAGAGGGG + Intronic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1158806793 18:60983387-60983409 CAGGGAAAAAAGGAAGAGATTGG + Intergenic
1159078477 18:63708236-63708258 CTGAGTAAAAGGGAAGACAGTGG + Intronic
1159121312 18:64175089-64175111 AAGGGTAGAGAGAAAGAGAGAGG - Intergenic
1159177591 18:64858479-64858501 GAGAGGAAAGAGAGAGAGAGAGG - Intergenic
1159532190 18:69669095-69669117 AAGAATAAAAGCAAAGAGAGAGG - Intronic
1159925443 18:74264892-74264914 CAGAGTAATAAAAAAGAAAGCGG + Intronic
1161019178 19:1999988-2000010 AAAAGAAAAAAGAAACAGAGTGG + Intronic
1161631988 19:5361853-5361875 CAAAGCAAAAAGACAGAGAGAGG + Intergenic
1161829050 19:6589715-6589737 AAGAGAAAAAAGACAGATAGAGG - Intronic
1161923064 19:7280904-7280926 AAAAGAAAAAAGAAAGAAAGAGG + Intronic
1162143745 19:8600447-8600469 GAGAAAAGAAAGAAAGAGAGAGG - Intronic
1162299950 19:9838810-9838832 CAGATGGAAAAGAAAGAGAATGG - Intronic
1162414692 19:10528342-10528364 CAAAAAAAAAAGAGAGAGAGAGG - Intergenic
1163196607 19:15726219-15726241 CAGACTGGCAAGAAAGAGAGTGG + Intergenic
1163258243 19:16170836-16170858 AAAAGAAAAAAGAAAGAAAGAGG + Intronic
1163276090 19:16285230-16285252 AAGAGGAAGAAGAAAGAGAAGGG + Intergenic
1164064671 19:21705641-21705663 CAGGGTGAAAAGGAAAAGAGGGG + Intergenic
1164101406 19:22057711-22057733 CAGATTAAAAAGAAAGTGTGAGG + Intronic
1164110383 19:22151445-22151467 CACAATTAAAAGAAATAGAGAGG + Intergenic
1164302431 19:23973561-23973583 AAGAGTAAAAAGAAGAGGAGAGG + Intergenic
1164531667 19:29053207-29053229 CAGAGGAGAGAGAGAGAGAGAGG + Intergenic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1164729003 19:30487549-30487571 CAAAAGAAAAAGAAAGAGGGAGG - Intronic
1164780838 19:30890792-30890814 TAGAGACAAAAGAAAGACAGTGG - Intergenic
1164866889 19:31611939-31611961 AAGATGAAATAGAAAGAGAGAGG + Intergenic
1165053073 19:33155558-33155580 CAGAGGAGTAAGTAAGAGAGGGG + Intronic
1165335708 19:35168341-35168363 CAGAGTGACAGGGAAGAGAGGGG + Intronic
1165483118 19:36077594-36077616 CAAAAAAAAAAGAAAGAAAGAGG - Intronic
1165638157 19:37361481-37361503 CACAGAAAAGAGAAAGAGAAAGG - Intronic
1165705548 19:37973799-37973821 CACAGTAAAAAGGCACAGAGAGG - Intronic
1165912624 19:39238308-39238330 CAGAGTATAAAGAAAAGGACAGG + Intergenic
1165981662 19:39729306-39729328 CAGAGAAAAATGAGAGAGTGTGG - Intergenic
1166012432 19:39952468-39952490 GAGAGACAAAAGAAAGAAAGAGG + Intergenic
1166138222 19:40790347-40790369 CAAAAAAAAAAAAAAGAGAGAGG - Intronic
1166553953 19:43685807-43685829 CAGAAAAGAAAGAAAGAGAAGGG + Intergenic
1166717923 19:44980650-44980672 AAGAGTAAAAAGGTAAAGAGAGG + Intronic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1167189556 19:47975127-47975149 CAGAGAAAAAAGGAAGAGATGGG - Intronic
1167836113 19:52071885-52071907 CACAGTCAAAAGACAGAGACTGG + Intronic
1168081789 19:54015410-54015432 GAGAGAAGAAAGAAAGAAAGAGG - Intergenic
1168228270 19:55011945-55011967 CAGAGCAAAGAGCAAGACAGGGG + Intergenic
1168230675 19:55029081-55029103 AAGAAGAAAAAGAAAGAAAGAGG + Intronic
1168341753 19:55628097-55628119 CATAGAAAAATGAAAGGGAGAGG - Intergenic
1168516118 19:57011540-57011562 GAGAGGAAAGAGAGAGAGAGAGG - Intergenic
1168535232 19:57163440-57163462 CAAAGAAAAAAAAAAGAGAGAGG - Intronic
925004922 2:434990-435012 CAGAAAAAAAAGAAAAAGAAAGG - Intergenic
925599171 2:5590547-5590569 CAGAGGTCAGAGAAAGAGAGGGG + Intergenic
926267858 2:11343526-11343548 CAGACTAAAAGGAGAGAGTGAGG + Intronic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
926975052 2:18506429-18506451 GAGGGAAAAAAGAAAAAGAGGGG - Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927073337 2:19551628-19551650 CACAGTCCAAAGAAGGAGAGAGG - Intergenic
927083168 2:19650270-19650292 AGGAGAGAAAAGAAAGAGAGGGG + Intergenic
927632641 2:24787757-24787779 CAGAGAAAACAGGAAGAGATGGG - Intergenic
927662972 2:25008492-25008514 AAAAGAAAAAAGAGAGAGAGAGG - Intergenic
927835723 2:26397004-26397026 CAGAGGAAAAAAGATGAGAGTGG - Intergenic
927925665 2:27011854-27011876 AAAAAAAAAAAGAAAGAGAGAGG + Intronic
928360668 2:30659786-30659808 AAAAGAAAGAAGAAAGAGAGGGG - Intergenic
928825993 2:35421644-35421666 CACAGTAAACAGGATGAGAGTGG - Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929217148 2:39426882-39426904 AAGAGAAACAAGAAAGAGATAGG + Intronic
929719100 2:44348577-44348599 CAGAGCCAAAAGCAACAGAGCGG + Intronic
929806978 2:45154725-45154747 GAGAGAGAAAAGAGAGAGAGAGG - Intergenic
930077239 2:47416543-47416565 CAGAGTACATAGTAATAGAGTGG + Intronic
930215239 2:48689712-48689734 CAAAAAAAAAAGAGAGAGAGAGG - Intronic
930348955 2:50224666-50224688 AAGATTAAAGAGAGAGAGAGAGG + Intronic
930443966 2:51446895-51446917 AAGAGTAGAAAGAATGAGAAAGG - Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931087506 2:58849508-58849530 AAAAAAAAAAAGAAAGAGAGAGG + Intergenic
931102880 2:59022089-59022111 AAGAGTAGAGAGAAAGATAGTGG + Intergenic
931142039 2:59471248-59471270 GAGAGTAAAAATCAAGAAAGTGG + Intergenic
931214377 2:60227528-60227550 CGGAGGTCAAAGAAAGAGAGTGG + Intergenic
931840358 2:66142006-66142028 CAGAATTAAAAGAACTAGAGAGG - Intergenic
931945100 2:67297660-67297682 GAGGGGAAAAAGAAAGTGAGAGG + Intergenic
932017466 2:68046411-68046433 CTGTTAAAAAAGAAAGAGAGAGG + Intronic
932255871 2:70285824-70285846 CATAATAAAAAGTAAGATAGAGG + Intronic
932516206 2:72352533-72352555 TAGATTAAAGAGAAAGAAAGAGG + Intronic
932536136 2:72597720-72597742 TAGATTAAAAATAAAGAGATGGG + Intronic
932823634 2:74921559-74921581 CAGAGGAAAAGGAAAGAGTCTGG - Intergenic
932952186 2:76306556-76306578 CAGAGAAGGAAGAAAAAGAGTGG - Intergenic
933025666 2:77254870-77254892 CAGAGAAATAGGAAAGAGAGAGG + Intronic
933245348 2:79968825-79968847 CAAAGTAAAAAAAAAAAGAAGGG - Intronic
933276229 2:80287200-80287222 CTGAGTAGAAAGAAAAGGAGAGG + Intronic
933277048 2:80295016-80295038 GAAAGAAAAAAGAAAAAGAGAGG - Intronic
933453154 2:82483092-82483114 GAAAGAAAAAAGAAAGAGGGAGG - Intergenic
933497956 2:83075052-83075074 CAGAGACGAAAGAAAGGGAGAGG - Intergenic
933592865 2:84251851-84251873 GAGAGAGAAAAGAAAGAGAAAGG + Intergenic
934056165 2:88253116-88253138 AAGAGGAAAAAGAAAGAGAGAGG - Intergenic
934124082 2:88869413-88869435 CTGAGAAGAAAGAGAGAGAGAGG + Intergenic
934129584 2:88935267-88935289 AAGAGTAAAAAAATAAAGAGAGG + Intergenic
934463607 2:94238480-94238502 AAGAAAAGAAAGAAAGAGAGAGG + Intergenic
934742524 2:96735492-96735514 CAGAGTGACAAGACAGAGACTGG - Intronic
934756703 2:96829221-96829243 GAGAGAAAAAAGACAGAGGGTGG - Intronic
934818221 2:97348653-97348675 CAGAGTAACAAGAGACAGAGAGG - Intergenic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
935212784 2:100952909-100952931 CAAATTTAAAAGAAAGAGTGCGG + Intronic
935420805 2:102866923-102866945 TACATTAAAAAGAAAGAAAGGGG + Intergenic
935514361 2:104018307-104018329 TAGAGTCAAAAGGAAAAGAGAGG - Intergenic
935803319 2:106721773-106721795 AAAAGTAAAATAAAAGAGAGAGG - Intergenic
935850784 2:107216611-107216633 CACAGAAAAAAGAAACAAAGAGG - Intergenic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
936043021 2:109164162-109164184 AAAAGAAAAAAAAAAGAGAGAGG - Intronic
936094250 2:109519712-109519734 CTGGGTAAAAAGAAAGACACAGG + Intergenic
936563290 2:113560769-113560791 CAGAGGAAAAAGAAAATGCGAGG + Intergenic
936652420 2:114443528-114443550 CCGAATAAAAACAAAGAGAATGG - Intronic
936675729 2:114711648-114711670 CAGAGTAAAAACAAAGGGTCAGG - Intronic
936848717 2:116870379-116870401 CACAATAAAAAGAGATAGAGAGG - Intergenic
937065874 2:119017144-119017166 CAGACAAGGAAGAAAGAGAGGGG + Intergenic
937344988 2:121119894-121119916 CACAGTGGAAAGACAGAGAGTGG + Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
937979276 2:127604750-127604772 CAGAGAAAAGAGAGAGAGATGGG + Intronic
938016565 2:127872206-127872228 AAGATTAAAAAAAAATAGAGGGG + Intronic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938757745 2:134396434-134396456 CAAACAAAAAAGAAAAAGAGAGG - Intronic
938771008 2:134500784-134500806 AAGAGTAAAAAGTAAAACAGAGG + Intronic
939026931 2:137025172-137025194 CATAGTGAGAAAAAAGAGAGAGG - Intronic
939068256 2:137509306-137509328 GAAAGAGAAAAGAAAGAGAGAGG - Intronic
939168136 2:138661678-138661700 CAGAGCATAGAGCAAGAGAGTGG - Intergenic
939176253 2:138751037-138751059 CAGGGTAATGAGAAAGAGATGGG - Intronic
939211682 2:139183611-139183633 CTGTCTAAAAAGACAGAGAGAGG - Intergenic
939212457 2:139194201-139194223 CAGACTAAGAAGAAAGAAAATGG - Intergenic
939221260 2:139304160-139304182 AAGATGGAAAAGAAAGAGAGAGG + Intergenic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
940067315 2:149644320-149644342 CAAAGTAATAAAAAAGAAAGTGG - Intergenic
940105439 2:150094184-150094206 CAGAGTAAAAAGACAGGGCATGG + Intergenic
940115513 2:150204196-150204218 AGGAGAAAGAAGAAAGAGAGAGG + Intergenic
941270652 2:163423366-163423388 CATAGTACAAGGAAAGAAAGTGG - Intergenic
941281403 2:163556149-163556171 TATTGTAAAGAGAAAGAGAGAGG + Intergenic
941462912 2:165793416-165793438 CAGAGTCGAAACAGAGAGAGAGG + Intronic
941521383 2:166548760-166548782 CAAAGTCAAAAGGAAGTGAGTGG + Intergenic
942068147 2:172291297-172291319 CAGGAGAGAAAGAAAGAGAGTGG - Intergenic
942113375 2:172704162-172704184 CACAGTAAGAATAAATAGAGGGG - Intergenic
942655316 2:178208807-178208829 TACATTAAAAAGAAAGAAAGGGG - Intronic
942881382 2:180865276-180865298 CAGAGCAAAAAGAAAGAATCTGG + Intergenic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
943293892 2:186112716-186112738 TAGAATAAAAAGATATAGAGTGG - Intergenic
943355874 2:186854667-186854689 AATATTAAAAAGAAAGAAAGAGG + Intergenic
943388406 2:187230747-187230769 CAGAATGTAAAGAAATAGAGTGG - Intergenic
943501912 2:188701584-188701606 CAGAGAAAAAAGAAAAACATTGG + Intergenic
943537795 2:189174247-189174269 AAGAGCAGAAAGTAAGAGAGAGG + Intronic
943542257 2:189231388-189231410 AAGAGAATAAAGAAAGAGAAAGG + Intergenic
943709737 2:191077812-191077834 AAGAGAAAAAAGAAAGAGTTTGG - Intronic
943826525 2:192401157-192401179 CAGAGAAAAAAAAAAAAAAGAGG - Intergenic
944066094 2:195620405-195620427 CAGAGTTCAGAGAAAGAGAGGGG + Intronic
944528679 2:200646813-200646835 CAGAGTTAAAAGAGACAAAGAGG - Intronic
944552000 2:200852568-200852590 AAGAGAAAAAAGAGAGAGAGAGG + Intergenic
944854698 2:203756031-203756053 CAAAAAAAAAAGAAAGAAAGGGG - Intergenic
945570935 2:211466872-211466894 GAGAGAAAAGAGAGAGAGAGAGG - Intronic
945768528 2:214010868-214010890 GTGAGTAAAAAGAAAGTGGGAGG + Intronic
945814192 2:214583903-214583925 CAGGGTAAGAATAAAGAAAGTGG + Intergenic
945897484 2:215500708-215500730 CAGAGAAAAAAGGAAGGAAGAGG - Intergenic
946085038 2:217162416-217162438 CAGAGTAAAAAGAGAAAAAAGGG + Intergenic
946294351 2:218771970-218771992 CAGAGTAAAAAGAAACGAATAGG - Intergenic
946517003 2:220423463-220423485 AACAGTAGAAAGAATGAGAGTGG - Intergenic
946571815 2:221032694-221032716 CAGAGAAAAATGAAAGTAAGAGG - Intergenic
946611154 2:221459309-221459331 GAGAGGAAAAAAAAATAGAGGGG - Intronic
947397308 2:229698908-229698930 AAGAGTAAAAATGAAGATAGAGG + Intronic
947443356 2:230142368-230142390 TAAAGTATAAAGAAAGACAGTGG + Intergenic
947536486 2:230943059-230943081 GAGAGAGAAAAGAGAGAGAGAGG + Intronic
947558824 2:231126993-231127015 AAGAGTAAAAAGATATGGAGTGG - Intronic
947696086 2:232190571-232190593 GAGAGAAAGAAGAGAGAGAGAGG + Intronic
947809903 2:232997746-232997768 CAGAGGAAAAGGACAGAGGGTGG - Intronic
948090658 2:235292083-235292105 AAAAAGAAAAAGAAAGAGAGTGG + Intergenic
948272228 2:236683453-236683475 CAGAGGAAAGGGGAAGAGAGAGG - Intergenic
948315703 2:237026918-237026940 CAGAGGAAAAAGAAACTGAAGGG + Intergenic
948389983 2:237605005-237605027 AAGAAAAAAAAGAAAGAAAGCGG + Intergenic
948435584 2:237951487-237951509 AAGAGAAGAAAGAAAGAGAAAGG + Intergenic
948435732 2:237952788-237952810 CAGAAAAGAAAGAAAGAGAAAGG + Intergenic
1168754508 20:306750-306772 AAGAGGAGAAAGAAAGAGAGAGG - Intergenic
1169061390 20:2663108-2663130 CAGAGCAAGAAGAAACAAAGAGG + Intronic
1169254159 20:4084516-4084538 CAGAGAGAGAAGACAGAGAGGGG + Intergenic
1169419899 20:5451517-5451539 GAGAGAAGAAAGAAAGAGAAAGG + Intergenic
1169478213 20:5951081-5951103 AAGAGTAAAAAGAAACAGTTGGG - Intronic
1169505783 20:6209487-6209509 AAGAGAAAAAAGAGAAAGAGAGG - Intergenic
1169507884 20:6232887-6232909 AAAAGAAAGAAGAAAGAGAGAGG - Intergenic
1169633376 20:7659436-7659458 AAAAAGAAAAAGAAAGAGAGAGG + Intergenic
1169735582 20:8834257-8834279 CAGAGAATTAAGAAAGAAAGAGG + Intronic
1170013342 20:11752397-11752419 GAGATTAAAAAAAAAGAAAGGGG - Intergenic
1170365229 20:15590889-15590911 GAGAGAAAAGAGAGAGAGAGAGG + Intronic
1170397317 20:15940824-15940846 CAGAGCGAAAAGACAGAAAGTGG + Intronic
1170421022 20:16193431-16193453 CAAAGTAAGAAGAAAGAAGGGGG + Intergenic
1170540568 20:17383240-17383262 CATAGCAAAAAGACAGAGATAGG - Intronic
1170658018 20:18308591-18308613 AAGACTAAAAAGAAATAAAGAGG - Intronic
1170670477 20:18428154-18428176 AAAAAAAAAAAGAAAGAGAGTGG + Intronic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1170762899 20:19266391-19266413 CAGAGGGAAAAGAAATACAGTGG - Intronic
1170832654 20:19856532-19856554 CAGAAAAAAAAAAAAGAGAGAGG + Intergenic
1171089604 20:22271498-22271520 CAGACTAAAGAGAGAGAGAGAGG + Intergenic
1171114517 20:22513122-22513144 GAGAGAGAAAAGAGAGAGAGAGG - Intergenic
1171157393 20:22888924-22888946 CAGATTAAAAAAAAACACAGTGG + Intergenic
1171877194 20:30587607-30587629 CTGAAAAAAAATAAAGAGAGTGG - Intergenic
1171924210 20:31175642-31175664 CAGAATCAAAAGGAAGAGAGTGG + Intergenic
1172015907 20:31872710-31872732 CACACGAAAAAGAAAAAGAGTGG + Intronic
1172543134 20:35737560-35737582 CAAAGAAAAAATAAAGACAGAGG + Intronic
1172572928 20:35984441-35984463 CAGATTAAGAAGAAGGGGAGTGG + Intronic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172822430 20:37749271-37749293 AATAGAAAAAAGAATGAGAGTGG - Intronic
1172931222 20:38587720-38587742 AAGGGAAAAAAGAAAGAAAGAGG - Intronic
1173051612 20:39567738-39567760 AACAGAAAAAAGAGAGAGAGGGG - Intergenic
1173082963 20:39887199-39887221 AAGAAAAAAAAGAGAGAGAGAGG - Intergenic
1173500877 20:43552230-43552252 CAGAATAAAAAGAAAAAGAGAGG + Intronic
1173578066 20:44126125-44126147 CAGAAGAAAAAGAGAGAGGGAGG + Intronic
1173622546 20:44447930-44447952 CAGAGCAAACAGGAAGAGAGAGG + Intergenic
1173660869 20:44732726-44732748 GAGAGATAGAAGAAAGAGAGAGG - Intergenic
1173706889 20:45116401-45116423 AAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174079288 20:47959627-47959649 AAAAGTAAAATGAAGGAGAGGGG - Intergenic
1174500189 20:50978638-50978660 AAAAGAAAAAAGAAAAAGAGAGG - Intergenic
1174967734 20:55237953-55237975 CAGAGGAACAAGAAAGAGATGGG + Intergenic
1174985587 20:55448093-55448115 TACAGAAAAAAGAAAGAGAGAGG - Intergenic
1175423982 20:58852950-58852972 TGGAGCAAAAAGAAAGAGAGAGG + Exonic
1175472564 20:59241305-59241327 CTGATTAAAAAAAAATAGAGGGG - Intronic
1175820369 20:61905865-61905887 CAGCTTGAAAAAAAAGAGAGTGG + Intronic
1176456376 21:6916023-6916045 CAGAGGACAAAGGAAGAGAGTGG - Intergenic
1176752229 21:10700144-10700166 CAGAGTGGAATGAAAGAGAATGG - Intergenic
1176834550 21:13781083-13781105 CAGAGGACAAAGGAAGAGAGTGG - Intergenic
1176878768 21:14166703-14166725 AAGTGAAAAAAGAAATAGAGAGG + Intronic
1176899169 21:14418805-14418827 CAGAGGGAGAAGAGAGAGAGAGG + Intergenic
1177202825 21:17977221-17977243 CAGAGTATAAAGAACTAAAGGGG - Intronic
1177249355 21:18572163-18572185 CAAAGTACAGAGATAGAGAGAGG + Intergenic
1177346649 21:19881911-19881933 CAAAGGTAGAAGAAAGAGAGTGG + Intergenic
1177420127 21:20845696-20845718 AAGAAAAGAAAGAAAGAGAGTGG - Intergenic
1177452289 21:21285982-21286004 CTGAGTGACAAGGAAGAGAGAGG + Intronic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177902060 21:26928633-26928655 CAAAGGAAAGAGAAAGAAAGAGG - Intronic
1178264831 21:31133270-31133292 CAGAGTAATAGGAAAGAGAAGGG - Intronic
1178356859 21:31916668-31916690 AAAAAAAAAAAGAAAGAGAGAGG - Intronic
1178461821 21:32809344-32809366 GAGAGGAAAAAGAAAGAAAGAGG - Intronic
1178587036 21:33879350-33879372 CAGAAAAAAAAGAAAGATTGAGG + Intronic
1178806162 21:35841383-35841405 CAGAGTGAGAAGACAGAGTGTGG + Intronic
1179025018 21:37672759-37672781 GAGAGAAGAAAGAAAGAGAAAGG - Intronic
1179356875 21:40668031-40668053 CAGAGTTAATAGAATGAGACTGG - Intronic
1179648799 21:42793260-42793282 AAGAAAAAAAAGAAAGAGCGGGG + Intergenic
1180897005 22:19343249-19343271 CATATTCAAAAGAAAGAAAGAGG + Intronic
1181149511 22:20873128-20873150 CAGAATTAAAACAAAGAGAGAGG - Intronic
1181321567 22:22011062-22011084 TAGATTAAAAAGAAAAAGCGAGG + Intergenic
1181389807 22:22572003-22572025 AAGAAAAGAAAGAAAGAGAGAGG + Intergenic
1181891800 22:26069765-26069787 AGGAGGAAAAAGAAAGAGAGGGG - Intergenic
1181923513 22:26339303-26339325 GAGAGAAAGAAGACAGAGAGAGG + Intronic
1182249108 22:28985384-28985406 CAGGGCAAAACGAGAGAGAGAGG - Intronic
1182301522 22:29339845-29339867 CAGAGAAACAAGAGAGAGAAGGG + Intronic
1183486929 22:38093173-38093195 AAAAGAAAAAAGAAAGAGTGTGG + Intronic
1183718354 22:39547518-39547540 CAGAGGGAAAAGAGAGAGAGAGG - Intergenic
1184428017 22:44424449-44424471 CAGAGCAGAAAGATGGAGAGAGG - Intergenic
1185252183 22:49809118-49809140 CAGAGGAAAAATAAAGAAAAAGG + Intronic
949385465 3:3497242-3497264 CAGAGGAAAAAAAAAGTGGGGGG + Intergenic
949437031 3:4040786-4040808 CAGAGTAACTAGAACCAGAGAGG + Intronic
949658035 3:6243755-6243777 GAGAGAAAAATGAAAGAAAGAGG - Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950671273 3:14527208-14527230 CAGAGACAGAAGAGAGAGAGGGG + Intronic
950895623 3:16447967-16447989 AAGAGAGAAAAGAAGGAGAGAGG - Intronic
951113756 3:18835671-18835693 AAGAGGAAAAAGAGACAGAGGGG - Intergenic
951745240 3:25970976-25970998 GAAAGTAGAAAGAAAGAGAGAGG - Intergenic
951935868 3:28022680-28022702 CACACTCAAAAGAAAGAAAGAGG - Intergenic
951991493 3:28680092-28680114 CAGAGTCAAGAAAATGAGAGAGG + Intergenic
952013476 3:28929862-28929884 CAGAGAAAAGAGAAATTGAGTGG - Intergenic
952084212 3:29798018-29798040 CTGAGGACAAAGAAAGAGATGGG + Intronic
952160565 3:30689259-30689281 CAGAGAAAAAAGAAAACGATAGG + Intronic
952164002 3:30725741-30725763 CAGAGTAAAAAGATAGAGCATGG - Intergenic
952518853 3:34133873-34133895 CAGAATAGACAGAAAGGGAGAGG + Intergenic
952683728 3:36124929-36124951 CAGAGAGAAGAGAGAGAGAGAGG + Intergenic
952848204 3:37706246-37706268 CAGAGGGAGAAGATAGAGAGAGG - Intronic
952940525 3:38440984-38441006 AAGAGGAAAGAGAGAGAGAGGGG - Intergenic
953051778 3:39350795-39350817 CAGAGAAAAAAAAAAAGGAGAGG + Intergenic
953236555 3:41112485-41112507 GAAAGAAAAAAGAAAGAAAGAGG + Intergenic
953284558 3:41594045-41594067 AAGAGAGAAAAGAGAGAGAGGGG + Intronic
953500098 3:43424888-43424910 CAGTGAAAGAAGAAAGGGAGAGG + Intronic
953501796 3:43443608-43443630 AAGAGTCAAAACAATGAGAGAGG + Intronic
953514123 3:43572932-43572954 AAGATTAAAAAGGAAGAGAGAGG + Intronic
953903649 3:46857525-46857547 CAGAGAGGAAAGAAGGAGAGAGG + Intergenic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954156964 3:48690802-48690824 AAGAAAAAAAAGAGAGAGAGAGG + Intronic
954185084 3:48910792-48910814 CTGAGTAAATGGAGAGAGAGTGG + Intergenic
954429520 3:50462886-50462908 AAAAGAAAAAAAAAAGAGAGAGG + Intronic
954600684 3:51865462-51865484 GAGATTAATAAGAAACAGAGTGG + Intergenic
954738141 3:52723756-52723778 CAGAGAAAGAGGAGAGAGAGGGG + Intronic
954944701 3:54410358-54410380 AAAAGAAAAAAAAAAGAGAGAGG + Intronic
955148513 3:56344055-56344077 CAGAGTAAACAGGCAGAGAGAGG + Intronic
955522105 3:59785035-59785057 CCGAGCAACAAGAGAGAGAGAGG + Intronic
955640063 3:61072908-61072930 GAAAGTAACAAGAAAGAAAGGGG + Intronic
955774695 3:62420762-62420784 GAGAGTAAAAATAAAGCAAGAGG - Intronic
955910807 3:63858150-63858172 CAGAGTGAAAAGAAACAAATGGG - Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956090228 3:65658705-65658727 TGGATTAAAAAGAGAGAGAGAGG - Intronic
956182002 3:66526220-66526242 CAGAGTAAAAAAAAAAATTGGGG - Intergenic
956193046 3:66625291-66625313 AAGAGTAAAAATAAAGAAAGTGG + Intergenic
956304624 3:67810334-67810356 CACAGTAAAATAATAGAGAGGGG + Intergenic
956321676 3:68004508-68004530 CACAGTAAAAAAAAAGACATCGG - Exonic
956327912 3:68073451-68073473 AAGAGGAAAAAGAAAGAGTTAGG - Intronic
956486032 3:69722794-69722816 AAGAGAAGAAAGAAAGAAAGAGG + Intergenic
956513890 3:70024855-70024877 CAGAGGAAAAGGAGTGAGAGAGG + Intergenic
956561978 3:70588651-70588673 CAGATTAAAATGCAAGAGAAGGG + Intergenic
956637467 3:71380507-71380529 CAGAGTGAAAAGAAAGCAAAGGG - Intronic
957125600 3:76156248-76156270 CAAAGTAATAAGAAAGTAAGAGG + Intronic
957177701 3:76832971-76832993 CACAATAAAAACAAAGGGAGAGG + Intronic
957202669 3:77157167-77157189 GAGAATAATAAGAAAGATAGGGG - Intronic
957968584 3:87353873-87353895 CAGACTAAAAAGTAAGGAAGTGG + Intergenic
958097424 3:88964387-88964409 CTTAGAAAAAAGAAAGGGAGAGG - Intergenic
958447260 3:94231134-94231156 CAAAGAATAAAGAAAGAAAGTGG - Intergenic
958689524 3:97445698-97445720 TAGATTAAAAAAAAATAGAGGGG + Intronic
959070905 3:101701307-101701329 CAGTGTAAAATGAAAGTGTGAGG + Intergenic
959084544 3:101837180-101837202 CTTAGAAAAAGGAAAGAGAGTGG - Intronic
959227648 3:103605551-103605573 CAAATGAAAAAGAAAGAGAAAGG + Intergenic
959251428 3:103952864-103952886 GAAAGAAAAAAGAAAGAGAGAGG + Intergenic
959407537 3:105978789-105978811 CAGAGAAACAAGAGATAGAGAGG - Intergenic
959887872 3:111523339-111523361 AAAAGTAAGAAGCAAGAGAGAGG - Intronic
959992411 3:112643963-112643985 AAGAATAAAAAGAAAAGGAGGGG + Intronic
960254811 3:115500738-115500760 CACAGAAAATAGAAAGAAAGAGG + Intergenic
960328643 3:116328713-116328735 CAAAGTAAAATGAGAGAGAGAGG + Intronic
960374923 3:116888518-116888540 GAGAGAGAAAAGAGAGAGAGAGG - Intronic
960444401 3:117729939-117729961 CAGAGCAAAAGGAAAGATAGAGG + Intergenic
960488647 3:118283085-118283107 CAGAGGAGAAAGAGAGAAAGAGG - Intergenic
960682267 3:120261999-120262021 AAGAAAAAAAAGAAAGAAAGCGG - Intronic
961067232 3:123885473-123885495 CAAATTAAAAAAAAAAAGAGTGG - Intergenic
961180513 3:124872756-124872778 CAGGAAAGAAAGAAAGAGAGAGG - Intronic
961690227 3:128664225-128664247 GAAAGAAAAAAGAAAGAAAGTGG + Intronic
961841385 3:129716144-129716166 CAAAGAAAAAAGAAAAAAAGTGG - Intronic
961908414 3:130287151-130287173 CTGAGTTTAAAGAAAGTGAGGGG - Intergenic
961908917 3:130293737-130293759 CATGGCAAAAAGAATGAGAGAGG - Intergenic
962122914 3:132582907-132582929 ACGACTAAAAAGGAAGAGAGAGG + Intronic
962609777 3:137065330-137065352 CATGGGATAAAGAAAGAGAGAGG + Intergenic
962893108 3:139690248-139690270 AAGAGGAAAAAGAAAAAGAAAGG - Intergenic
963050945 3:141143115-141143137 CAGTTTAAAAAGACAAAGAGGGG - Intronic
963115385 3:141724595-141724617 CAGAGCAAAGAGGATGAGAGAGG + Intergenic
963155341 3:142090508-142090530 CAGAAGACAAAGAAAGAGAATGG - Intronic
963165441 3:142197193-142197215 AAGAGAAAAAAAAAAGAAAGTGG + Intronic
963343694 3:144068944-144068966 GGGAGAGAAAAGAAAGAGAGGGG + Intergenic
963479227 3:145848996-145849018 AATATTTAAAAGAAAGAGAGAGG + Intergenic
963526083 3:146415172-146415194 TAGAGTAAAAATAAAGAAGGTGG + Intronic
963709216 3:148727237-148727259 GAGAGAAGAGAGAAAGAGAGAGG - Intronic
963772830 3:149406352-149406374 GAAAGAAAAAAGAAAGAGAAAGG + Intergenic
963796774 3:149638595-149638617 GAGAGAAAAAAGAAAGAGAATGG - Intronic
964188751 3:153978307-153978329 AAGAGAAAAAAGAAATTGAGAGG - Intergenic
964575551 3:158162827-158162849 GGCAGTAAAAAGGAAGAGAGTGG + Intronic
964588294 3:158332055-158332077 GAGACTAGCAAGAAAGAGAGAGG + Intronic
964964950 3:162481272-162481294 CAGAATAGAGAGAGAGAGAGAGG - Intergenic
965150212 3:164963405-164963427 CAAAATAAAAAGAAAGGGTGAGG + Intergenic
965344065 3:167525883-167525905 AAGAGGGAAAGGAAAGAGAGAGG - Intronic
965381873 3:167999715-167999737 CAGAGAAAAAGAAATGAGAGAGG + Intergenic
965503530 3:169484278-169484300 AAGAGAAAAAAGAAAGAAAGAGG + Intronic
965507016 3:169527758-169527780 CAGATTGCAAATAAAGAGAGAGG - Intronic
965517162 3:169633860-169633882 AAAAGGAAAAAGAAAGAGAGAGG + Intronic
965611362 3:170547150-170547172 GAGAATGAAAAGGAAGAGAGAGG - Intronic
965914586 3:173827858-173827880 TAGAGTAAAAAGGCAGAGAAAGG - Intronic
966043183 3:175517737-175517759 CATAGGAAAAAGAAAGATAAAGG + Intronic
966142226 3:176769487-176769509 GAAAGAAAAAAGAAAGAAAGAGG + Intergenic
966189183 3:177256223-177256245 CTGAAAAAAAAGAGAGAGAGAGG - Intergenic
966214325 3:177486408-177486430 CCCAGGAAAAAGAAAGAGACAGG + Intergenic
966318369 3:178674141-178674163 CAGAGGAGAGTGAAAGAGAGTGG - Intronic
966323848 3:178732069-178732091 GAGAGAAAAAAGACAGAGAGAGG + Intronic
966927396 3:184654012-184654034 CAGAGAAATAAAAAACAGAGGGG + Intronic
967034803 3:185640316-185640338 CAGAGGAAAGGGAAAGAGATAGG - Intergenic
967144836 3:186597826-186597848 GAAAGAAGAAAGAAAGAGAGAGG - Intergenic
967205105 3:187112484-187112506 AAGAGAAAAGAGAAAGAGAAAGG - Intergenic
967283525 3:187846039-187846061 CATAGAAGAAAGAAAGAGAGAGG - Intergenic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967627767 3:191705560-191705582 CAGACAAATAAGAAAGAGAAAGG + Intergenic
967664806 3:192158493-192158515 GAAAGAAAAAGGAAAGAGAGAGG - Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
968057314 3:195702149-195702171 AAAATTAAAAAGAGAGAGAGAGG - Intergenic
968301097 3:197615922-197615944 AAAAATAAAAAGAAAGAAAGTGG - Intergenic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
969228755 4:5815595-5815617 CAGAGAAGAATAAAAGAGAGAGG + Intronic
969237138 4:5873536-5873558 CACAGGAAGAAGAGAGAGAGTGG + Intronic
970070048 4:12148038-12148060 AGCAGTAGAAAGAAAGAGAGAGG + Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970672420 4:18412107-18412129 AAGAAAAGAAAGAAAGAGAGAGG - Intergenic
970674460 4:18432754-18432776 CAAAATATAAAGGAAGAGAGGGG - Intergenic
970719215 4:18966558-18966580 AAGAAAAAAAAGAAAGAAAGTGG + Intergenic
970803089 4:19999560-19999582 GAGAGGAAAAAAAAAGAGAGTGG + Intergenic
970852970 4:20623806-20623828 CAGAATAGAGAGAAAGAAAGGGG + Intergenic
970963156 4:21897044-21897066 AAGAGTTAAATGCAAGAGAGAGG - Intronic
970986971 4:22170421-22170443 CAGGGTACCCAGAAAGAGAGGGG + Intergenic
971190925 4:24428343-24428365 CAGGGGGAAAAGAGAGAGAGAGG - Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971578884 4:28308477-28308499 GAGAGGAAAGAGAGAGAGAGAGG + Intergenic
971715419 4:30169336-30169358 GAGAGAGAAAAGAGAGAGAGAGG - Intergenic
971732923 4:30408549-30408571 CACACAAAAAAGAAAGAGAAAGG + Intergenic
972015010 4:34232678-34232700 AAGAGAAAAAAGAAAGAAAAGGG - Intergenic
972069592 4:34999979-35000001 CAGAGAAGATAGAAATAGAGGGG - Intergenic
972228638 4:37044216-37044238 CATAGGAAAAAGAAAAAGTGTGG - Intergenic
973128169 4:46614902-46614924 CAGAGAAGAAGGAAAGAGACAGG - Intergenic
973228980 4:47820155-47820177 GGCAGTCAAAAGAAAGAGAGAGG + Intronic
973619119 4:52710106-52710128 CAAAGGGAAAAGAAAGGGAGAGG + Intergenic
973736469 4:53876459-53876481 CACAAAAGAAAGAAAGAGAGAGG + Intronic
973791346 4:54380813-54380835 AAGAGGGAACAGAAAGAGAGAGG - Intergenic
973969725 4:56200347-56200369 CAGATTAGAAAGAAAAAGAATGG + Intronic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974466497 4:62263474-62263496 GAGAGGAGAGAGAAAGAGAGAGG + Intergenic
974467561 4:62276569-62276591 CAGAGTAAAAAAAAAAAGTAAGG + Intergenic
974474192 4:62358998-62359020 CGGGGTAAGAAGAGAGAGAGAGG + Intergenic
974688411 4:65263922-65263944 AAGATTAAAATGAAAGATAGTGG + Intergenic
974855962 4:67460790-67460812 GAGGGAGAAAAGAAAGAGAGTGG + Intergenic
974913444 4:68150194-68150216 CAGTTTAAATAGCAAGAGAGAGG + Intergenic
975273078 4:72461277-72461299 TAGAGTAGAAAGAAATAGAGTGG + Intronic
975674779 4:76815545-76815567 CTGAGCAAAAAGAATGAAAGTGG - Intergenic
975704834 4:77101413-77101435 AAGAAAAAAAAAAAAGAGAGAGG - Intergenic
975840709 4:78470823-78470845 AGGAGGAAACAGAAAGAGAGGGG + Intronic
976104154 4:81599058-81599080 CAGATTAAAAAGAAAGGAACTGG - Intronic
976220820 4:82755504-82755526 CAGAAAAGAAAGAAAGAAAGGGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976412962 4:84738292-84738314 CAGATTGAAAAAAAAAAGAGAGG + Intronic
976506782 4:85856398-85856420 CATTGTAAAAAGTAAGAAAGTGG - Intronic
976512721 4:85929976-85929998 CAAAGTCAAAAGAAAAAGAAAGG + Intronic
976544597 4:86319893-86319915 GAGAGTAGAAAGAGAGATAGAGG - Intronic
976580578 4:86730935-86730957 TAGAGTAGAAAGAATGAAAGTGG - Intronic
976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG + Intergenic
976822893 4:89226933-89226955 CAGAGAACAAAGAAAGAGTGTGG - Intergenic
976890999 4:90047633-90047655 TAGAGGAAAAATGAAGAGAGGGG + Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
976975606 4:91162996-91163018 CACAATAAAAAGAAGTAGAGAGG - Intronic
977008897 4:91610824-91610846 AAGAAAAAAAAGAGAGAGAGAGG - Intergenic
977266378 4:94860874-94860896 CAGAATAAAATGAAAGAAAATGG - Intronic
977266389 4:94861029-94861051 CAGAATAAAATGAAAGAAAATGG - Intronic
977332232 4:95651809-95651831 CATTTTAAAAAGGAAGAGAGAGG - Intergenic
977566418 4:98585308-98585330 CAAAAAAAAAAGAGAGAGAGTGG - Intronic
978082703 4:104614101-104614123 CTCAGTAAAAAGACATAGAGCGG - Intergenic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
978332831 4:107633614-107633636 CAGCGTAAAAAGAATGGGATTGG + Intronic
978336818 4:107678322-107678344 CAGAGTAAAAGTGAAGAGAAAGG + Intronic
978456576 4:108899181-108899203 CTGAGCAAAAAGACAGAGATTGG + Intronic
978473962 4:109104719-109104741 CAGAAAAAAAAGAGAGAGAGAGG + Intronic
978569992 4:110126369-110126391 CAGAGTAAAACAAGGGAGAGGGG + Intronic
978689934 4:111495707-111495729 CAAAGCAAAGAGAAAGAGAGAGG + Intergenic
978755551 4:112298282-112298304 CAAAGTAAAAAGAAAGTAAAAGG - Intronic
978828609 4:113054843-113054865 GTGAGTAAATAGAAACAGAGAGG - Intronic
978883029 4:113731189-113731211 CAAAGTAAAAACAAAGATAATGG + Intronic
978898258 4:113916672-113916694 ACCAGGAAAAAGAAAGAGAGTGG - Intronic
978976588 4:114882663-114882685 CAGAATAGGAAAAAAGAGAGTGG + Intronic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979038005 4:115750038-115750060 CATATTAGAAAAAAAGAGAGGGG - Intergenic
979331247 4:119423096-119423118 GAAAGAAAAAAAAAAGAGAGAGG + Intergenic
979348510 4:119618423-119618445 CATATTAAAATAAAAGAGAGAGG + Intronic
979383893 4:120041376-120041398 CAAAGAAAAATGAAAGAGTGAGG + Intergenic
979455388 4:120921860-120921882 CAAATTAAAAAAAAAAAGAGCGG + Intronic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
979624377 4:122828298-122828320 TAGAGGAAAGAGAAAGAAAGGGG + Intronic
979832955 4:125323042-125323064 CAGAGAAGAAAGTTAGAGAGAGG - Intronic
980380157 4:132003364-132003386 CACAAGAAAGAGAAAGAGAGAGG + Intergenic
980384282 4:132066466-132066488 GAGATGAAAAAGAAAGAGAGAGG + Intergenic
980407896 4:132377653-132377675 CAGATTAAAAAGAAACATATTGG - Intergenic
980480548 4:133381471-133381493 CAGAATAAAAAGTCAGAGAAGGG + Intergenic
980635417 4:135495696-135495718 CAGAGTAAAAAGAATTAGTGGGG + Intergenic
980745991 4:137016723-137016745 TTGAGTAAAAAGATAGAGAGAGG - Intergenic
980816403 4:137951966-137951988 AAGAGAAGAAAGAAAGAGAGAGG + Intergenic
980987607 4:139710934-139710956 TAGGGGAAAAAGAAAGAGAGTGG + Intronic
980990253 4:139733451-139733473 CACTGGGAAAAGAAAGAGAGAGG + Intronic
981091635 4:140738446-140738468 GGGAGTAAAAAGGGAGAGAGAGG - Intronic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
981572354 4:146166208-146166230 CAAAAAAAAAAGAGAGAGAGAGG - Intergenic
982129028 4:152210423-152210445 CAGGAAAGAAAGAAAGAGAGAGG + Intergenic
982213086 4:153056879-153056901 CAGACTCAAAAGAAACTGAGGGG + Intergenic
982412188 4:155090982-155091004 GAGAAGAAAAAGAGAGAGAGTGG + Intergenic
982464422 4:155712689-155712711 CAAAGAAAAAAGTAAGAGGGAGG + Intronic
982779066 4:159471647-159471669 AAAAGAAAAAAGAAAGACAGAGG - Intergenic
983180978 4:164648746-164648768 CAGAGAAATAAACAAGAGAGTGG + Intergenic
983233478 4:165152917-165152939 AAGAGAGAAAAGGAAGAGAGAGG - Intronic
983441419 4:167791246-167791268 CAGGGCAAAGAGAGAGAGAGAGG - Intergenic
983516886 4:168666844-168666866 CAGAAAAAAAAGAAAGAGACTGG + Intronic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984438521 4:179734953-179734975 AACAGTAAAAAGAAAAAGAAAGG - Intergenic
984605695 4:181783346-181783368 CAGAGGAGAAAGATAGAGACAGG - Intergenic
984610426 4:181830646-181830668 CAGAGTAAAGAGACAAAGATTGG + Intergenic
984632858 4:182078746-182078768 CAGAGGAAATAGAGAGAGAGAGG + Intergenic
984875315 4:184362660-184362682 CAAAGAAAACAGAAACAGAGAGG + Intergenic
985292065 4:188396261-188396283 TAGAGTAAAAGGACATAGAGAGG + Intergenic
985382533 4:189410131-189410153 AAGAGAAGAAAGAAAAAGAGGGG - Intergenic
985390378 4:189486282-189486304 CAGTGCAAGAAGAAAGAAAGAGG + Intergenic
985393614 4:189517246-189517268 CTGAGCAAAAAGAAAGCAAGGGG + Intergenic
985922059 5:2985207-2985229 AAGAGAAATAAGAAAGAGAGAGG + Intergenic
985946669 5:3190498-3190520 CAAAGTAGAAAGAAAGAGAGAGG + Intergenic
986150799 5:5128999-5129021 CAGAAGAAAGAGAGAGAGAGGGG - Intergenic
986207791 5:5642193-5642215 AAAAGGAAAGAGAAAGAGAGAGG + Intergenic
986450481 5:7858468-7858490 CCAATTACAAAGAAAGAGAGAGG - Intronic
986481405 5:8192067-8192089 CAGCGTCAACAGGAAGAGAGGGG - Intergenic
987079211 5:14411266-14411288 CAGACTAATAAGGAAGAGACAGG - Intronic
987277642 5:16378464-16378486 CAGAGAAAAATGGAAGAGAAAGG - Intergenic
987353228 5:17039945-17039967 GAAAGAATAAAGAAAGAGAGAGG - Intergenic
987396329 5:17427986-17428008 CAGAAAAAAATGAAAGAAAGAGG - Intergenic
987936208 5:24468607-24468629 CAAAAAAAAAAAAAAGAGAGAGG - Intergenic
988174439 5:27703128-27703150 TAGAGTGAAAAGCAAGTGAGAGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988251549 5:28764768-28764790 AAGAAAGAAAAGAAAGAGAGAGG + Intergenic
988298139 5:29391641-29391663 CAGAAGAAAAGGAAAGAGCGTGG + Intergenic
988329392 5:29815329-29815351 GAGAGAAAAAAGAAAGCAAGAGG + Intergenic
988346061 5:30039402-30039424 CAGAAGAAAAAGAGAAAGAGAGG + Intergenic
988831970 5:34996714-34996736 CAAAAAAAAAAGAGAGAGAGAGG - Intergenic
989285951 5:39700095-39700117 AAGAGAGAAAAGAGAGAGAGAGG + Intergenic
989439306 5:41451634-41451656 CATAAAAAAAAAAAAGAGAGAGG - Intronic
989540489 5:42612652-42612674 AAGAGTATAAACAAAGAGAAAGG + Intronic
989636297 5:43538805-43538827 AAGAGTGAAATGAAAGAGAGAGG - Intronic
989790746 5:45397586-45397608 CAGAGCAAAATGAAAATGAGGGG + Intronic
990006848 5:50954164-50954186 CAGTGCAGAAAGAAAGAGTGAGG + Intergenic
990130724 5:52579838-52579860 AAAAGTAAACAGAAAGAGTGAGG - Intergenic
990152441 5:52834509-52834531 GAGAGAAAGAAGAAAGGGAGAGG + Intronic
990466239 5:56074379-56074401 GAGACAAGAAAGAAAGAGAGAGG - Intergenic
991152392 5:63385714-63385736 GAGAGAAAAAAGAAAGAGTTAGG + Intergenic
991161208 5:63505916-63505938 AAGAGTGAAAAGAAAGTGAGTGG - Intergenic
991629990 5:68646916-68646938 TAAAGAAAAAAGAAAGGGAGGGG + Intergenic
991656913 5:68913525-68913547 CAGAGTGAAAATAATGAGAGGGG - Intergenic
991670501 5:69042503-69042525 CAAAAAAAAAAGAATGAGAGAGG + Intergenic
992230906 5:74663165-74663187 AAAAGGAAAAAGAAAGAAAGAGG - Intronic
992407465 5:76473337-76473359 CACAGGAAAAAAAAAGAGAAAGG - Intronic
992504487 5:77373089-77373111 CAGAACAATAAAAAAGAGAGAGG - Intronic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993075445 5:83225065-83225087 CAGTCTAACAAGAAGGAGAGAGG - Intronic
993216529 5:85030412-85030434 CATCTGAAAAAGAAAGAGAGTGG - Intergenic
993327165 5:86555378-86555400 CAGACTAAAAAGGCACAGAGTGG + Intergenic
993465864 5:88246107-88246129 CATAGTAAAGAGATAGAGTGAGG - Intronic
993712934 5:91245987-91246009 CAGATTAAAAGGTGAGAGAGAGG + Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
993835303 5:92812503-92812525 CAGAGAAGAAAGAAAGATAAAGG + Intergenic
993979573 5:94528965-94528987 GACAGTTAAAAAAAAGAGAGTGG + Intronic
994156154 5:96506458-96506480 CAGAGAAAAATGAAACAGAAAGG - Intergenic
994320029 5:98384166-98384188 CAAAAAAAAAAGAAAAAGAGAGG - Intergenic
994457916 5:100036995-100037017 CAGAGAAAGAAGAGAGAGAGAGG + Intergenic
994531155 5:100973360-100973382 CAAAGTAAAAATAAAGGGATGGG + Intergenic
994650438 5:102520255-102520277 CAGAATAGAAAGACAGAGGGAGG + Intergenic
994650480 5:102520579-102520601 AAAACAAAAAAGAAAGAGAGAGG + Intergenic
994865013 5:105256792-105256814 CACAGGAAAAAAAAAGAGAAAGG - Intergenic
995053067 5:107728688-107728710 CAGAGTCAGAAGAGAGAGTGAGG - Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
995319021 5:110810112-110810134 TAGATTGAAAAGAAATAGAGGGG + Intergenic
995845956 5:116494061-116494083 CACAGGATAAAGAGAGAGAGAGG - Intronic
996074528 5:119174781-119174803 TAGAGGAAAGAGAAAGAGAAAGG - Intronic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996406181 5:123106445-123106467 TAGACAAAAAAGAGAGAGAGAGG + Intronic
996486959 5:124047088-124047110 TAGAGTGAAGAGAAAGAGAGAGG + Intergenic
996828178 5:127709140-127709162 GAGAGAAAGAAGAGAGAGAGAGG + Intergenic
997083333 5:130766445-130766467 CATAGTAAGAAGAAATGGAGGGG - Intergenic
997200713 5:132008556-132008578 CTGAGTCAAGAGGAAGAGAGTGG - Intronic
998262421 5:140641699-140641721 CAGAGGAAAAGGAGAGAGAGGGG + Exonic
998400465 5:141846161-141846183 CAGAGGAAGAGGAGAGAGAGAGG - Intergenic
998425148 5:142020054-142020076 CAAATTAAAAAGAAAAAGAAAGG - Intergenic
998476523 5:142426954-142426976 CAGAGGGGAAAGAAAGAGGGGGG - Intergenic
998522107 5:142810486-142810508 CACACAAAAAAGAAAGAGATGGG - Intronic
998672722 5:144371951-144371973 CAGAGTAAAAAAATTGAGAAGGG - Intronic
999087659 5:148907374-148907396 CAGAGTAATGTGATAGAGAGTGG + Intergenic
999155794 5:149456674-149456696 AAAAGAAGAAAGAAAGAGAGAGG + Intergenic
999393214 5:151209562-151209584 CAGAAGAAAAAGAAAGAAATTGG - Intronic
999528960 5:152440854-152440876 CAAAAAAAAAAAAAAGAGAGAGG - Intergenic
999675791 5:154001264-154001286 CAGAGTAAAAGGACAGAGAATGG + Intronic
999789795 5:154928663-154928685 CAGATTAAAAAGAAGGCCAGTGG + Intronic
999936985 5:156497710-156497732 GAGAGTAAAAAGGAAAAGAAAGG + Intronic
1000353659 5:160372642-160372664 CAGAGAGTAAAGACAGAGAGAGG - Intergenic
1000574671 5:162963337-162963359 CGGAATAAAAAGAAATAGAATGG + Intergenic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1000756598 5:165168874-165168896 TAGTGTAACAAGAAAGAAAGTGG - Intergenic
1001007900 5:168070829-168070851 AAGAAGAAAAAGAAAAAGAGAGG + Intronic
1001184876 5:169560696-169560718 AAGGGAAAAAAGAGAGAGAGAGG + Intergenic
1001221291 5:169903096-169903118 CAAAAAAAAAAGAAAGAAAGGGG + Intronic
1001469427 5:171999712-171999734 CAGAAGAAAAAGAAAGACTGAGG - Intronic
1001660165 5:173385222-173385244 CAGAAAAAAAAGAAAAAGAATGG - Intergenic
1001903707 5:175453272-175453294 GAGAGGAGAAAGAGAGAGAGGGG + Intergenic
1001918678 5:175583305-175583327 GAGAGGAATAAGAGAGAGAGTGG + Intergenic
1001944285 5:175766027-175766049 AGCAGGAAAAAGAAAGAGAGGGG + Intergenic
1002184001 5:177445841-177445863 AAGAGAAAGAAGAAAGAGAAAGG - Intergenic
1002401310 5:178992892-178992914 GAGAGAAACAAGAAGGAGAGAGG + Intronic
1003253528 6:4454660-4454682 CAGAGGAAAAAGAAAGAATGAGG + Intergenic
1003327321 6:5101810-5101832 CAGAGTGAAAAAAAAGAGAGAGG - Intergenic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003487032 6:6588751-6588773 CAGAGTCCAGAGGAAGAGAGTGG - Exonic
1003736745 6:8886309-8886331 AAAAGGAAAAAGAAAGACAGAGG - Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1003901474 6:10659577-10659599 CAGAAGAAAAAGAGAAAGAGAGG + Intergenic
1004104180 6:12649574-12649596 CAGAGGAGAAAGAAAGAGACAGG - Intergenic
1004352795 6:14904831-14904853 CAAAAAAAAAAGAAAGAGAGAGG + Intergenic
1004620342 6:17325765-17325787 CAGAAGAAAAGGAAAGAGTGTGG - Intergenic
1004649185 6:17592135-17592157 AAGAATCAAAAGAATGAGAGAGG + Intergenic
1004904460 6:20223337-20223359 GAGAGAAAACAGAAAGAGAGGGG + Intergenic
1004962345 6:20804323-20804345 GAGAGAAAATAGAATGAGAGAGG + Intronic
1005006209 6:21290029-21290051 ATAAGAAAAAAGAAAGAGAGTGG + Intergenic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005444131 6:25903606-25903628 CAAAGTATAATGAAGGAGAGAGG + Intergenic
1005471124 6:26163683-26163705 AGGAGAAAAAAGAAAGAGAAAGG + Intronic
1005578224 6:27209941-27209963 TAGAAAAAAAAGAGAGAGAGAGG - Intergenic
1005619905 6:27610360-27610382 AAAAGAAAAAAGAAAGAAAGAGG + Intergenic
1005755194 6:28919910-28919932 CAGAGTTAAAAAGAAGACAGGGG + Intronic
1005762583 6:28980889-28980911 CCGAGGAAAAGGATAGAGAGAGG - Intergenic
1005816962 6:29561306-29561328 AAGAGTAAAGAGAGAGAGAGAGG - Intronic
1005822307 6:29607997-29608019 CAGAGGAAAAAGAGAGAGCAAGG + Intronic
1005832070 6:29679473-29679495 GAGAGAGGAAAGAAAGAGAGAGG - Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006304997 6:33213514-33213536 CAGAGGAAACAGGAAGTGAGGGG - Intergenic
1006565932 6:34957147-34957169 CAGAGTAAAAACAAACAAAAAGG - Intronic
1006745507 6:36339207-36339229 CACAATAAAAAGAAGGGGAGGGG + Intergenic
1006748146 6:36359474-36359496 AAAAGAAAAAAGAAAGAAAGGGG + Intronic
1006980923 6:38147166-38147188 GAGAGTGAAAAGAGAGAGACTGG - Intronic
1006998928 6:38290150-38290172 CAGAGAAGAAAGGAAGGGAGAGG + Intronic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007530926 6:42541551-42541573 CACAGGGAAAAGAATGAGAGAGG + Intergenic
1008025233 6:46628634-46628656 CAGAGTACAAAGTAGGAGAGAGG + Intronic
1008075089 6:47137450-47137472 CCAAATAAAAAGAAAAAGAGAGG + Intergenic
1008135289 6:47769253-47769275 CAGAATATGAAGAAAGTGAGAGG - Intergenic
1008304143 6:49880496-49880518 CTGAGTAAAAAGAATGAAACTGG - Intergenic
1008354393 6:50534077-50534099 AAAAAAAAAAAGAAAGAGAGAGG + Intergenic
1008367849 6:50703774-50703796 TAGAGGAAGAAGAAAGAGGGAGG - Intergenic
1008504556 6:52216943-52216965 CAGAGTTTTAGGAAAGAGAGAGG - Intergenic
1008512224 6:52287030-52287052 CAGAGTATACAGGAAGAGAATGG + Intergenic
1008739132 6:54583913-54583935 GAGAGGAAAAACAAACAGAGTGG - Intergenic
1009295900 6:61946827-61946849 GATAGTCAGAAGAAAGAGAGAGG - Intronic
1009697397 6:67124938-67124960 CAGAGAAAAAAAGAAGATAGAGG - Intergenic
1009799050 6:68509624-68509646 TAAATTAAAAAGGAAGAGAGAGG - Intergenic
1009829864 6:68916397-68916419 GTGAGAGAAAAGAAAGAGAGAGG - Intronic
1010002993 6:70967127-70967149 CAGAGCAAAAACATAGAGAAAGG + Intergenic
1010112851 6:72261640-72261662 AAGAGGAAAGAGAAAGAAAGAGG + Intronic
1010160964 6:72854705-72854727 GTGTGTACAAAGAAAGAGAGAGG - Intronic
1010466740 6:76176187-76176209 CAGAGAAAAAGGACAGAGAAAGG + Intergenic
1010474659 6:76272215-76272237 GAAAGAAAAAAGAAAGAGAAAGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010548840 6:77194178-77194200 CAGAGGAAAAAGAAAACCAGAGG + Intergenic
1010835498 6:80582880-80582902 TAGAGAAAAAAGAAAGAGCAGGG + Intergenic
1011152154 6:84286323-84286345 AAAAGGAGAAAGAAAGAGAGAGG - Intergenic
1011190080 6:84719304-84719326 GAGAGGAAAGAGAGAGAGAGGGG - Intronic
1011370268 6:86629692-86629714 CTGAGGAAAAAGAAAGGCAGAGG + Intergenic
1011520090 6:88195371-88195393 ACAAGGAAAAAGAAAGAGAGAGG - Intergenic
1011522541 6:88225025-88225047 CAGAGTAAAAAACAAGAGTTGGG - Intergenic
1011617552 6:89211002-89211024 CAGAGAAATAAGAAAGAGAATGG + Intronic
1012039003 6:94180383-94180405 CTGAGTAAAAAGACACAGAGGGG - Intergenic
1012098438 6:94996759-94996781 CCTAATAAAAAAAAAGAGAGAGG - Intergenic
1012188121 6:96247244-96247266 CAGAGTAAGGAGGTAGAGAGTGG + Intergenic
1012355410 6:98308047-98308069 CACAATAAAAAGAATGAGATCGG - Intergenic
1012415547 6:99009269-99009291 CAAAGAAAAAAGAAAGAAAATGG - Intergenic
1012649107 6:101730741-101730763 AATAGAGAAAAGAAAGAGAGAGG + Intronic
1012673433 6:102085935-102085957 AAAAGAAAATAGAAAGAGAGAGG + Intergenic
1012706768 6:102540983-102541005 AAGAGTAAAAATAAATAAAGTGG - Intergenic
1012745945 6:103088823-103088845 AAAAGGAAAAAGAGAGAGAGAGG - Intergenic
1012746480 6:103096499-103096521 CAGAATAAACAGAAATACAGGGG - Intergenic
1012798895 6:103800358-103800380 CAGAGTAAAAACAAAAAGGGAGG + Intergenic
1013055041 6:106575118-106575140 CAGAGTTAAAATACAGAGGGGGG + Intronic
1013055741 6:106581032-106581054 GAGAGAAAGAAGAGAGAGAGAGG + Intronic
1013254161 6:108367513-108367535 TAGAGTATGAAAAAAGAGAGAGG + Intronic
1013730834 6:113164772-113164794 AAGACAAAAAAGAAAAAGAGAGG + Intergenic
1013760523 6:113512201-113512223 CAGAGTAAAAGAAAAAAGTGGGG + Intergenic
1014291836 6:119567094-119567116 AATAGTCAAAAGAAAGAGAAAGG - Intergenic
1014678694 6:124400623-124400645 AAGAGAAAAAAGAAAGAAATAGG - Intronic
1015074286 6:129136026-129136048 CAGAGAAAAAAAAAAGTGAGAGG + Intronic
1015209811 6:130684104-130684126 CAGAGTGAAAGGAAACAGAAGGG + Intergenic
1015358475 6:132307944-132307966 CACAGTTAAAAGAGATAGAGAGG + Intronic
1015515608 6:134079906-134079928 AATAGGAAAAAGAAAGAGAAAGG - Intergenic
1015767676 6:136736280-136736302 CAGAGTAGAAAGAAAGGGTATGG - Intronic
1015818945 6:137239597-137239619 CAAAAGAAAAAAAAAGAGAGAGG + Intergenic
1015989511 6:138922539-138922561 CAGAAAAAGAAGAAAAAGAGAGG + Intronic
1016028495 6:139313370-139313392 CAGATTAAAAAGAGAAAGACAGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016200540 6:141402228-141402250 AAGAATCAAAAGAAAGAGATTGG + Intergenic
1016241609 6:141938082-141938104 TAGATTAAGAAGAAAGAGATTGG + Intergenic
1016503439 6:144748837-144748859 AAAAGGAAAAAGGAAGAGAGGGG - Intronic
1016513096 6:144864911-144864933 CAGAGAAGAGAGAAAGAGAGAGG - Intergenic
1016523862 6:144977393-144977415 CACAGTATAAACAAAGAGACCGG - Intergenic
1016612979 6:146013879-146013901 CAGAAACAAAAGAAAGGGAGAGG - Intergenic
1017096497 6:150809866-150809888 CAAAATAAAAACAAAGAGACTGG + Intronic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017272747 6:152528113-152528135 GAGAGGAGAAAGAAAGAGAAAGG - Intronic
1017282636 6:152640189-152640211 CAGAAGAAAAAGCAAGGGAGGGG + Intergenic
1017529322 6:155272967-155272989 CAAAGTAGAAAGAAAGAGAGAGG + Intronic
1017538395 6:155373177-155373199 GAGAGAAGAAAGACAGAGAGAGG - Intergenic
1017554829 6:155551771-155551793 CATAGGAAAAAGAAAGAGATTGG + Intergenic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018097497 6:160403138-160403160 CAGACTAAGAAAAAAGAAAGAGG + Intronic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018268340 6:162050467-162050489 GAGATGAAAAAAAAAGAGAGGGG - Intronic
1018322406 6:162625577-162625599 CAGAGTAGAAAAAAAGAGGAAGG - Intronic
1018542471 6:164897438-164897460 GAGAGGAGAGAGAAAGAGAGAGG - Intergenic
1018548413 6:164963667-164963689 CAGAGGAGCAAGAGAGAGAGGGG - Intergenic
1018779139 6:167046289-167046311 CACACTAGAAAGAAAGAAAGAGG + Exonic
1019046315 6:169150297-169150319 CAGAGTTAAAAAAAAAAGATTGG - Intergenic
1019546577 7:1579998-1580020 GAGAGGAAAGAGACAGAGAGTGG - Intergenic
1019825287 7:3279453-3279475 CAGAGCAGAGGGAAAGAGAGAGG + Intergenic
1020202820 7:6093568-6093590 AAAAGAGAAAAGAAAGAGAGAGG - Intergenic
1020595001 7:10195453-10195475 GAGAAAAAAAAGAAAGAGACAGG - Intergenic
1020603021 7:10300342-10300364 CAGAGAAAAGAGAGTGAGAGAGG - Intergenic
1020622666 7:10536549-10536571 CAGAATAAAAAGAGAAAGAAGGG + Intergenic
1020823188 7:12996136-12996158 AAGAGAAAAAGAAAAGAGAGAGG - Intergenic
1020873245 7:13661133-13661155 CAGAGTAAAAAAAAAAAAAAAGG + Intergenic
1020929856 7:14379461-14379483 CAGAGAATAAGGAAAGAGAGTGG + Intronic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021036617 7:15807887-15807909 GAGAGAAAAAAGAAAAAGAATGG - Intergenic
1021041582 7:15869379-15869401 CAGAGGAGAAAGAGAGGGAGAGG + Intergenic
1021089452 7:16465816-16465838 CAGAGTGAAAACACAGAGAAGGG + Exonic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1022448126 7:30486747-30486769 CAGAAAAAAAAGAAAGAAAGTGG - Intergenic
1022613847 7:31907951-31907973 CAGAATGAAAAAAAAGGGAGGGG + Intronic
1022617393 7:31945862-31945884 CAAAGGAAAAAGAAAAAGAATGG - Intronic
1022674015 7:32481443-32481465 CAGAATAAAAGGACAGAGAGAGG + Intergenic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023496152 7:40799475-40799497 CAGAGTAAAAGGATAGACAAGGG + Intronic
1023556423 7:41427892-41427914 CAGTGTAAAAAAGAAGAGGGAGG - Intergenic
1023740868 7:43279498-43279520 CATAGTAAAAAAGAAGAGCGTGG - Intronic
1023774636 7:43593078-43593100 CAGACCAAACAGTAAGAGAGTGG - Intronic
1024079922 7:45847762-45847784 GGGAGAAAAAAGAGAGAGAGAGG - Intergenic
1024144182 7:46494865-46494887 CAAAGTTATAAAAAAGAGAGTGG + Intergenic
1024393470 7:48840731-48840753 AAGTGTTAAAAGAAACAGAGGGG - Intergenic
1024440342 7:49408893-49408915 CAGAGCAAAAAAAAAAAGGGGGG + Intergenic
1024807062 7:53154329-53154351 GAGAATAAAAAGAAACTGAGTGG + Intergenic
1024904893 7:54366030-54366052 CAGTGTAAAAGGAAAAAGAGAGG - Intergenic
1024920405 7:54547569-54547591 AAAAGTAATAAGCAAGAGAGTGG - Intronic
1024955854 7:54918762-54918784 CAGAATCAAAAGACAGAGAGAGG + Intergenic
1026039908 7:66859583-66859605 CACAGTAAGAAAAAAGAAAGAGG - Intergenic
1026216194 7:68351408-68351430 GAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1026253584 7:68691509-68691531 CACAGTACAGAGAAAGAGAAGGG + Intergenic
1026517630 7:71086639-71086661 AAGAAAAAAAAGAAAGAGAAGGG + Intergenic
1026606401 7:71819681-71819703 CAGAGAAACAAAAAATAGAGTGG - Intronic
1026654122 7:72241873-72241895 ATGACTAAAAAGAGAGAGAGAGG - Intronic
1027358116 7:77379576-77379598 GAGAGCAAAAAGAGAGAGAGAGG - Intronic
1027382147 7:77622358-77622380 CAGAGTAAAATGAAAAAGATGGG + Intronic
1027454816 7:78376289-78376311 CTGAGAAAGATGAAAGAGAGCGG - Intronic
1027537670 7:79425758-79425780 CAGACAAAATAGAGAGAGAGAGG + Intronic
1027611861 7:80371032-80371054 GAAAGTAAAAAGAATGAGAAAGG + Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027807826 7:82852060-82852082 AGGAGTAAAAAGAAAGGAAGGGG + Intronic
1027910961 7:84249928-84249950 CAGAGTAAAAAAAAAAAAACAGG - Intronic
1028055820 7:86241293-86241315 GAGAGAAAAAATAAAGAGGGAGG + Intergenic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028231289 7:88309288-88309310 CAGACTAATAGGCAAGAGAGGGG + Intergenic
1028438992 7:90837539-90837561 CAGATTACACAGAAAGAGATGGG + Intronic
1028544735 7:91985646-91985668 CACAGAAAAAAGAAAGGGGGTGG - Intronic
1029040681 7:97570320-97570342 CAGAAGAAAAGGAAAGAGAGAGG + Intergenic
1029051516 7:97693892-97693914 TAGAGTAAATAGGAAGAGAGGGG + Intergenic
1029391447 7:100277443-100277465 CAAAAAAAAAAGAGAGAGAGAGG - Intergenic
1029634135 7:101772729-101772751 AAGAGAAGAAAGAAAGAGGGAGG + Intergenic
1029733933 7:102455193-102455215 GAAAGAAAAAAGAAAGAGAAAGG + Exonic
1030101250 7:105947380-105947402 CCTAGTAAAAAGAAAGAAAATGG - Intronic
1030246963 7:107393305-107393327 CAGAGTACCAAGAATGGGAGTGG - Intronic
1030849376 7:114463851-114463873 CAGAGTAAGAAGAAAGAACAAGG + Intronic
1030927422 7:115476144-115476166 AAGAGAGAGAAGAAAGAGAGAGG + Intergenic
1030974050 7:116098840-116098862 AAAAGAAGAAAGAAAGAGAGAGG + Intronic
1031021909 7:116638161-116638183 GACCGTCAAAAGAAAGAGAGAGG - Intergenic
1031512630 7:122668864-122668886 CAGAGCAAAATGAAAGAGTAAGG - Intronic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032202879 7:129835370-129835392 GAAAGTAAAAAGAAAGCGTGGGG - Intronic
1032279728 7:130491195-130491217 CAGAGGCACAAGAAAGAGGGAGG - Intronic
1032282440 7:130515315-130515337 CACAGGAGAAAGATAGAGAGTGG + Intronic
1032580002 7:133095577-133095599 CACAGTACAAGGAAGGAGAGTGG - Intergenic
1032629923 7:133638609-133638631 CAGAGAAGAAAAAAAGAAAGAGG - Intronic
1032718329 7:134529840-134529862 TCCTGTAAAAAGAAAGAGAGAGG - Intronic
1032853995 7:135818927-135818949 CAGAGGAAAAAGAAGAGGAGAGG - Intergenic
1032945416 7:136846466-136846488 AAGGGAAAAAAGAAAGAAAGAGG + Intergenic
1032987434 7:137354194-137354216 AAGAGGAGAAAGGAAGAGAGAGG + Intergenic
1033253910 7:139782881-139782903 CAGAATTAAAATAAAGGGAGAGG - Intronic
1033263455 7:139864106-139864128 AGGATTAAAAAGAAAGAGAATGG + Intronic
1033383094 7:140843576-140843598 CAGAGTAAAAGCAGAGAGATGGG - Intronic
1033580975 7:142735193-142735215 CAGGCTCAAAACAAAGAGAGGGG + Intergenic
1033771775 7:144560339-144560361 CAGAGAAATAGGGAAGAGAGTGG - Intronic
1033864108 7:145667165-145667187 GAGAAAAAAAAGAGAGAGAGAGG + Intergenic
1033883703 7:145918119-145918141 AAGAGAAGAAAGAAAGAGAAAGG + Intergenic
1033964253 7:146954939-146954961 CAGCATCAATAGAAAGAGAGAGG + Intronic
1034000412 7:147406182-147406204 CAGAGAAAAAAGAAAAGGAAAGG + Intronic
1034248973 7:149672948-149672970 CAGAGAGGAGAGAAAGAGAGAGG + Intergenic
1034407281 7:150913468-150913490 CAGAGGAAGGAGAGAGAGAGGGG - Intergenic
1034525254 7:151655594-151655616 CAGAGCAAAAAGAAAATGAGAGG + Intronic
1034569013 7:151940369-151940391 AAGAGGAAAAAGACAGAAAGTGG + Intergenic
1035587484 8:787004-787026 CAAAAGAAAAAGAAAGAGAAAGG - Intergenic
1035999047 8:4581624-4581646 CAGTGTTAAAAGAAAGTTAGTGG + Intronic
1036084967 8:5603469-5603491 GAGAGAGAAAAGAGAGAGAGAGG + Intergenic
1036280847 8:7399893-7399915 CAGTGTCAGACGAAAGAGAGAGG - Intergenic
1036340618 8:7911678-7911700 CAGTGTCAGACGAAAGAGAGAGG + Intergenic
1036431610 8:8697014-8697036 CAGAGTGACAGGAAATAGAGGGG + Intergenic
1036577027 8:10037236-10037258 CAGTGTAAAATGAAAATGAGGGG - Intergenic
1036814660 8:11892502-11892524 AAAAATAAAAAGAAAGAAAGTGG - Intergenic
1037143189 8:15541567-15541589 CAGACTAAGAATAAAGAGAAAGG - Intronic
1037173520 8:15921503-15921525 TAGAATAAAAAGGCAGAGAGAGG - Intergenic
1037224675 8:16571452-16571474 AAGAAAAAAAAGAAAGAAAGAGG - Intergenic
1037456644 8:19071042-19071064 CAAAAAAAAAAGAAAGAGAGAGG - Intronic
1037594620 8:20344591-20344613 CAGATTAAAAAAAAAGGAAGTGG + Intergenic
1037691093 8:21182320-21182342 CAAAAAAAAAAAAAAGAGAGTGG + Intergenic
1038128252 8:24698377-24698399 CAGAGAAAAATGAAAGGAAGAGG - Intergenic
1038129023 8:24708314-24708336 AAAAAAAAAAAGAAAGAGAGAGG + Intergenic
1038208402 8:25491448-25491470 CAGAGAAATAAGAACCAGAGTGG + Intronic
1038572915 8:28678502-28678524 GAGAGAAAAAGCAAAGAGAGAGG - Intronic
1038659103 8:29481497-29481519 CTTAGAAAAAAGAAAGAAAGAGG - Intergenic
1038694502 8:29794090-29794112 CAGAGTACAAAGAGAGAAAGAGG + Intergenic
1038787127 8:30628546-30628568 CAGAGTAAGAAGATTGAGAAAGG + Intronic
1039150593 8:34500719-34500741 CAAAGGAAAAACAAAAAGAGAGG + Intergenic
1040093779 8:43422976-43422998 CAAAGTAAAAAGAAAGAACTCGG + Intergenic
1040806511 8:51402759-51402781 AACAATAAAAAGAAACAGAGTGG + Intronic
1040977081 8:53205448-53205470 CTCAGTAACAAGAAAAAGAGTGG + Intergenic
1041193243 8:55374573-55374595 CAGAGAAGAAAATAAGAGAGAGG + Intronic
1041335564 8:56778888-56778910 CAGAGTCTTCAGAAAGAGAGGGG - Intergenic
1041435099 8:57830552-57830574 CAGAGTAAAAATTAATAGATTGG - Intergenic
1041758644 8:61339927-61339949 GAAAGATAAAAGAAAGAGAGGGG + Intronic
1041796900 8:61754369-61754391 TAGAATAAAAAAAAAGAAAGGGG - Intergenic
1042071225 8:64937117-64937139 CAGAGTCAAGGGAAAGAGAAAGG + Intergenic
1042083394 8:65082160-65082182 GAGAGGAAAAAGAAAGGAAGAGG + Intergenic
1042161110 8:65896695-65896717 CAAAATAAAAAAAGAGAGAGAGG + Intergenic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042595350 8:70441237-70441259 AAGAGGAAAGAGAAAGAAAGGGG + Intergenic
1042595359 8:70441450-70441472 AAGAAAGAAAAGAAAGAGAGAGG + Intergenic
1042691297 8:71502306-71502328 CAGACAAAGAAGAATGAGAGGGG - Intronic
1042758663 8:72246816-72246838 CAGAGTAAATGGGAAGAGAAAGG - Intergenic
1043064642 8:75552965-75552987 CATAGTCAAAAGAAAAAAAGGGG + Intronic
1043288878 8:78570801-78570823 CACAGTAGAAAGAAAAAGAATGG - Intronic
1043466198 8:80509730-80509752 CAGTGGAAAAAGAATGAGATGGG - Intronic
1043478005 8:80623870-80623892 AAGAGAAAGAAGAGAGAGAGAGG + Intergenic
1043528920 8:81128508-81128530 CAGAGGAGGAAGTAAGAGAGAGG - Intergenic
1043585227 8:81760853-81760875 CAGAAGACAGAGAAAGAGAGAGG + Intergenic
1043609684 8:82046576-82046598 CAGATTCAAAAGAATGAGAAAGG + Intergenic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044194899 8:89363645-89363667 AAAAGTAAAATAAAAGAGAGAGG + Intergenic
1044365807 8:91343742-91343764 TAGATTAGAAAGAAAGAGAGAGG - Intronic
1044443634 8:92248561-92248583 CAGAGAGAAAATAAAGAGACTGG + Intergenic
1044715328 8:95094713-95094735 GAAAGAAAAAAGAAAGAAAGAGG - Intronic
1044905152 8:96992735-96992757 CAGAGTGGAAGGAAAGAAAGTGG - Intronic
1044913567 8:97088037-97088059 AAGAGAAACAAGAAAGAGAATGG + Intronic
1045478053 8:102569710-102569732 GAAAGAAAAAAGGAAGAGAGGGG - Intergenic
1045651038 8:104341854-104341876 CTGAGATAAAAGCAAGAGAGTGG + Intronic
1045663731 8:104465250-104465272 GGGAATAGAAAGAAAGAGAGGGG + Intronic
1045997498 8:108380305-108380327 CAGAGTATTAAAAAAGAGACGGG + Intronic
1046181309 8:110652432-110652454 CAGTGAAAAAACAAAGAAAGAGG - Intergenic
1046488378 8:114915818-114915840 CATAGGCAAAAGAAAGAGAAAGG + Intergenic
1046566793 8:115911976-115911998 GAAAGGAAAAAGAGAGAGAGAGG - Intergenic
1046581949 8:116103926-116103948 CAGGGTAAAAGGAGAGAAAGTGG - Intergenic
1046615014 8:116466823-116466845 CAGAGTAAACAGAAACAAATTGG + Intergenic
1047019032 8:120755196-120755218 GAGAGAAGAAAGAGAGAGAGAGG + Intronic
1047093952 8:121603740-121603762 CAAGGTATAAAGAGAGAGAGTGG - Intergenic
1047134451 8:122060007-122060029 TAGAGTAAAAATAAACAGTGTGG + Intergenic
1047155825 8:122317013-122317035 TGGAGTATAAAGAAAGAGAAAGG + Intergenic
1047181228 8:122590000-122590022 TAGAAGAAAAAGATAGAGAGTGG + Intergenic
1047330719 8:123884457-123884479 CAGAGGAAAGAGAAAGGCAGAGG + Intronic
1048203930 8:132400722-132400744 CAGCGTATAAAGAATCAGAGTGG + Intronic
1048376950 8:133831245-133831267 TAGAGGAAAAAGAAAGAAGGGGG + Intergenic
1049229266 8:141473597-141473619 CAAAAAAAAAAGAAAGAAAGAGG - Intergenic
1049722346 8:144124934-144124956 CAAAAAAAAAAGAAAGAAAGAGG + Intergenic
1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG + Intergenic
1049836928 8:144742008-144742030 CAGAGTAAAAACCAAGAGGCCGG + Intronic
1049862170 8:144906906-144906928 CAGAGAGAAAAAAAAGAGAGAGG - Intergenic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050214750 9:3309954-3309976 CAGAATAAAAGGACAGAGTGGGG + Intronic
1050434803 9:5597763-5597785 CAGAGCAAAGAGAGAAAGAGAGG + Intergenic
1050599653 9:7237627-7237649 CAGAGTAACAAGAGAGAGTGTGG + Intergenic
1050716120 9:8528261-8528283 CAGAGAAAGAAGAAAGAAAGAGG + Intronic
1050963702 9:11769542-11769564 AAAAAAAAAAAGAAAGAGAGAGG + Intergenic
1051173485 9:14342497-14342519 AAGAGAAAAAAGAAATAGGGAGG + Intronic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051293950 9:15575112-15575134 CAGATAAATTAGAAAGAGAGAGG + Intronic
1051375410 9:16397288-16397310 CATACTAAAAAGAAAAAAAGTGG + Intergenic
1051480422 9:17554070-17554092 GAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1051680990 9:19607793-19607815 CATTGGAGAAAGAAAGAGAGAGG + Intronic
1051763188 9:20491843-20491865 CATAGTACAAAGAAAGATTGGGG + Intronic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052079375 9:24185012-24185034 AAGAGTAAAAAGACAGTGACAGG - Intergenic
1052257912 9:26480895-26480917 CACAGTTAAAAGAACTAGAGAGG + Intergenic
1052610696 9:30769774-30769796 CACAGAAAGAAGAAAGAGTGGGG + Intergenic
1052702076 9:31949799-31949821 CAGGATAAAGAGAGAGAGAGGGG + Intergenic
1052899606 9:33780681-33780703 CAGGCTCAAAACAAAGAGAGGGG + Intronic
1052972978 9:34388921-34388943 AAAAAAAAAAAGAAAGAGAGAGG - Intronic
1053149754 9:35735924-35735946 TAGAATGAAAAGTAAGAGAGAGG + Intronic
1053210528 9:36223748-36223770 CAAAAAAAAAAAAAAGAGAGGGG - Intronic
1053218333 9:36291298-36291320 AAGAAAAGAAAGAAAGAGAGAGG - Intronic
1053452384 9:38203829-38203851 AAGAGAAAAAACAGAGAGAGAGG - Intergenic
1053752568 9:41271853-41271875 CTGAAAAAAACGAAAGAGAGTGG + Intergenic
1053940661 9:43245544-43245566 AAGAAAAGAAAGAAAGAGAGAGG + Intergenic
1054258095 9:62836205-62836227 CTGAAAAAAACGAAAGAGAGTGG + Intergenic
1054651059 9:67623961-67623983 GAGAGAAAAAAGACAGAGAAAGG + Intergenic
1054827661 9:69589392-69589414 CAGAGAAAGAAGAATTAGAGTGG - Intronic
1055186057 9:73455443-73455465 CATAAGAAAAAAAAAGAGAGGGG - Intergenic
1055542164 9:77321947-77321969 CAGAGGATAAAGAAAGAGTTTGG - Intronic
1055736735 9:79338248-79338270 CACAGTAAAAATAAACAGAAAGG - Intergenic
1055910080 9:81340161-81340183 CAGAAAACAAAGAAAGAGACAGG + Intergenic
1056090241 9:83198328-83198350 GACAGTAAAGAGAAAGAGAAAGG - Intergenic
1056165532 9:83937354-83937376 AAAAATAAAAAAAAAGAGAGTGG + Intergenic
1056503432 9:87233265-87233287 CAGAGTCAAAAGGAAGATACTGG - Intergenic
1056929797 9:90864562-90864584 AAGAGAAAAAAGTAAGAAAGTGG - Intronic
1057122278 9:92587105-92587127 CAGAGAAAAAAGAAAAAAACAGG + Intronic
1057333207 9:94135561-94135583 CAGAGGAGAAAGACAGAGGGAGG - Intergenic
1057402441 9:94736470-94736492 TAGAGTAAAAATGAAGAGATTGG - Intronic
1057767407 9:97934378-97934400 AAGAGAAAAAAGAAAAGGAGAGG + Intronic
1057973497 9:99579656-99579678 CAGAGTAATGGGACAGAGAGTGG + Intergenic
1058045760 9:100354942-100354964 CAGAGTAAAAAAGGGGAGAGTGG - Intergenic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058248607 9:102662870-102662892 CAAAATAAAAGAAAAGAGAGAGG - Intergenic
1058306338 9:103445900-103445922 CAGACTAAAAAAATAGAGAATGG - Intergenic
1058462110 9:105192464-105192486 CAAAGTAAAAAGAAAAAAATGGG - Intergenic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1058510409 9:105711917-105711939 CAGAAAAAAAAGAGAGAGAAGGG - Intronic
1058671778 9:107366452-107366474 CAGAGTAAGAAGAACCAGGGAGG - Intergenic
1058737291 9:107905368-107905390 CAGACAGAAAAGAAAGGGAGAGG - Intergenic
1058958861 9:109974010-109974032 TAGAGTCCAAAGGAAGAGAGAGG + Intronic
1059490804 9:114665992-114666014 GAAAGAAAAAAGAGAGAGAGAGG - Intergenic
1059527115 9:115002393-115002415 CAGAGCAGGAGGAAAGAGAGAGG + Intergenic
1059534547 9:115069391-115069413 CAGAGAGAAAAGGGAGAGAGAGG + Intronic
1059737726 9:117118908-117118930 CAGGGTAAAAAGATAGAGTGAGG - Intronic
1059832588 9:118114487-118114509 AAAAGAAAAAAAAAAGAGAGAGG + Intergenic
1059860474 9:118455034-118455056 AAGAGTAAAAAGAGAGAAAACGG - Intergenic
1059965507 9:119609785-119609807 AAAAGAAGAAAGAAAGAGAGAGG - Intergenic
1060249768 9:121976532-121976554 AAGAGAAAAAAGAAAAAGATAGG + Intronic
1060331879 9:122679615-122679637 GAGAGTTTAAAGAAAGAGCGTGG - Intergenic
1060519476 9:124286238-124286260 GAGCTTTAAAAGAAAGAGAGGGG - Intronic
1060590950 9:124816541-124816563 AATAGTAAAAAGAAAGCCAGTGG + Intergenic
1060768335 9:126311692-126311714 CAGAGCAGGAAGAGAGAGAGGGG + Intergenic
1061313558 9:129779592-129779614 GAAAGAAAAAAGAGAGAGAGAGG + Intergenic
1061634818 9:131900902-131900924 TACAGCAGAAAGAAAGAGAGAGG + Intronic
1061977439 9:134076763-134076785 CAGAGGAAAAAGAGAGAGTAAGG + Intergenic
1062413562 9:136436709-136436731 CAGAGAAAGAAAAAAGAGCGAGG + Intronic
1202800684 9_KI270719v1_random:172171-172193 CTGAAAAAAACGAAAGAGAGTGG - Intergenic
1185490915 X:516392-516414 GAGAGAAGAGAGAAAGAGAGGGG - Intergenic
1185504633 X:622395-622417 GAGAGAAGAGAGAAAGAGAGAGG + Intergenic
1185525222 X:773262-773284 GAAAGAAAAAAGAAAGAGAGAGG + Intergenic
1185534408 X:849388-849410 GAAAGAAAAAAGAAAGAAAGAGG - Intergenic
1185573326 X:1151555-1151577 AAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1185679146 X:1874000-1874022 GAGAGAAAAAAAAAGGAGAGAGG - Intergenic
1185725817 X:2420742-2420764 CAAAGTAAAAAAAAAAAGAATGG + Intronic
1185766850 X:2732562-2732584 AAGAATGAAAAGAGAGAGAGAGG - Intronic
1185943118 X:4343461-4343483 CAAGGTAAAAAGAAAGAAATTGG - Intergenic
1185964284 X:4582699-4582721 AAGATTAAAAAGAAAGATAGTGG + Intergenic
1186040359 X:5470427-5470449 CAGAGGATAAAGACAGAGAGGGG + Intergenic
1186072100 X:5833152-5833174 GAGAGATAAATGAAAGAGAGAGG - Intergenic
1186074892 X:5867372-5867394 AAGAGTAGAATGAAAGAGGGAGG - Intronic
1186096017 X:6102820-6102842 CAGATTAGATAGAGAGAGAGGGG + Intronic
1186107102 X:6219414-6219436 AAGAGAAAAAGGAAGGAGAGAGG - Intronic
1186122442 X:6378676-6378698 CAGAGGAAGAGGAAAGACAGAGG + Intergenic
1186249817 X:7653406-7653428 CAGAGAGAAAAGAGAGAAAGGGG - Intergenic
1186327838 X:8498886-8498908 GAAAGAGAAAAGAAAGAGAGAGG + Intergenic
1186640906 X:11454387-11454409 CAGAGTAAAGAAAAAGAGAAAGG + Intronic
1186687742 X:11943234-11943256 AAGAGTAAAAAGAAAAAGGCAGG - Intergenic
1186926410 X:14337359-14337381 TAGAGTTCAAAGAAAGAGAGTGG + Intergenic
1187063088 X:15806877-15806899 CAGAGGACAAGGAGAGAGAGAGG + Intronic
1187125271 X:16448657-16448679 CAAAGGAAACAGAAACAGAGAGG - Intergenic
1187150736 X:16679429-16679451 CAGAGGAAAAAGAGAGAAAGTGG + Intronic
1187247692 X:17567698-17567720 GAGAGAGAAAAGAAAAAGAGAGG + Intronic
1187680163 X:21759812-21759834 CAGTGTAGAGAAAAAGAGAGAGG - Intergenic
1187967386 X:24625755-24625777 TATAGTAAAAAGAGAGAGAAGGG + Intronic
1188169718 X:26910040-26910062 GAAAGTAAAAAGAGAGGGAGGGG + Intergenic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1189016910 X:37294502-37294524 GAGAGGAAGAAGAGAGAGAGGGG + Intergenic
1189060403 X:37747101-37747123 CTGATGAAGAAGAAAGAGAGGGG + Intronic
1189077270 X:37929580-37929602 CAGAGGAAAACAAAAGGGAGGGG + Intronic
1189128388 X:38472608-38472630 CAAAACAAAAAGAAAGAAAGGGG - Intronic
1189219996 X:39363402-39363424 AAGGGTAAGAAGACAGAGAGAGG + Intergenic
1189572988 X:42319566-42319588 TGGAGAAAAAAGAAAGAGAAAGG + Intergenic
1189604712 X:42664493-42664515 AAAAGGAAAGAGAAAGAGAGAGG + Intergenic
1189619812 X:42824170-42824192 CAGGGTAAAGAGGAAAAGAGAGG - Intergenic
1190016153 X:46828994-46829016 AAAAGAAAAGAGAAAGAGAGAGG + Intergenic
1190133605 X:47773572-47773594 AAGAGGAAAAAGAAACAGAGAGG + Intergenic
1190360840 X:49646587-49646609 AAAAAGAAAAAGAAAGAGAGAGG + Intergenic
1190581755 X:51897107-51897129 CAAAGAAAAGAGCAAGAGAGGGG - Intronic
1190866245 X:54387129-54387151 GAGAGAGAGAAGAAAGAGAGAGG - Intergenic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191219987 X:57977828-57977850 CACAGTAAGAATAAACAGAGGGG - Intergenic
1191659690 X:63636631-63636653 AGGAGAAAGAAGAAAGAGAGAGG + Exonic
1191940433 X:66474485-66474507 CAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1192061029 X:67826445-67826467 CAGACTAAAAGGAAAGAAATGGG + Intergenic
1192179824 X:68909437-68909459 CAGGGTAAAAGGAAAGAGAGTGG + Intergenic
1192197341 X:69037240-69037262 AAGAGAAAAAAGAAAGAGAGAGG - Intergenic
1192614287 X:72602287-72602309 GAGATTACAGAGAAAGAGAGAGG + Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1192806316 X:74512610-74512632 CTGAGTTGAAAGAGAGAGAGGGG - Intronic
1192908464 X:75578315-75578337 CACAGGAAATAGAAAGGGAGGGG - Intergenic
1193020568 X:76787963-76787985 CAGAGTAAACAGAAAACCAGCGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1193678746 X:84490164-84490186 AAGAGAAAAAAAAAGGAGAGAGG - Intronic
1194006247 X:88497518-88497540 CACAGTAAAAGGGAAGAAAGGGG - Intergenic
1194092613 X:89597855-89597877 CACAGCAACAAGAGAGAGAGCGG + Intergenic
1194326325 X:92522309-92522331 CAGAAGAAAAAGAGAGAGATGGG + Intronic
1195152384 X:102085112-102085134 CAAAATAAAAAGAAAGAGAGAGG + Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1195972551 X:110489594-110489616 CAGTTTAAAAAGACAAAGAGGGG - Intergenic
1196050387 X:111298101-111298123 CAGAGTAGAAAAAGAAAGAGTGG - Exonic
1196177318 X:112653504-112653526 CACAGAAAAAAGAAAGAGTTAGG + Intronic
1196845391 X:119893100-119893122 CAAAGAAAAAAAAAAGACAGTGG - Intergenic
1196882349 X:120209797-120209819 AAGAGTACAAAGAAATAAAGTGG - Intergenic
1197260473 X:124312060-124312082 CTGAGTAAAGAGGAAGAAAGGGG + Intronic
1197335080 X:125203337-125203359 CGGTCTAAAAAGAAAGAAAGGGG - Intergenic
1197384151 X:125782764-125782786 CAGAGGAAACAGAAAGGGATGGG - Intergenic
1197622835 X:128770378-128770400 CAGAATAAAAAAATAGAGAGAGG + Intergenic
1197661299 X:129176390-129176412 CAGACTGAAAATAAAGAGATGGG - Intergenic
1197757050 X:130002775-130002797 AAGAGTAAAGAGAGAGAGATGGG + Intronic
1197835585 X:130690501-130690523 CAGACTGCAAAGAAAGAAAGTGG + Intronic
1197889330 X:131251680-131251702 CTGAATAAAAACAAAGATAGTGG + Intergenic
1198225675 X:134642951-134642973 AAGAAGAAAAAGAGAGAGAGAGG + Intronic
1198254017 X:134909268-134909290 AAAAGAAAAAAGAAAGAAAGAGG + Intronic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1198261291 X:134967067-134967089 TAAAATAAAAAGAAAGAAAGAGG - Intergenic
1198397396 X:136234130-136234152 CAGAGAAAAAGCAAAGGGAGTGG + Intronic
1198408652 X:136342733-136342755 AAGACTAAAAAAAAACAGAGGGG + Intronic
1198655953 X:138913595-138913617 GAGAAGAAAAAGAGAGAGAGAGG + Intronic
1198736878 X:139795584-139795606 CAGAGTAAAATAAAAAAAAGGGG + Intronic
1198816809 X:140600158-140600180 CGGGGGAAAAAGAAAGAAAGTGG - Intergenic
1199025763 X:142935576-142935598 GAGAGTAGGTAGAAAGAGAGTGG - Intergenic
1199724505 X:150567921-150567943 TACAGTAAAAAGAAAGGGACAGG - Intergenic
1199837208 X:151603462-151603484 CAAAGAAATAAAAAAGAGAGGGG - Intronic
1199992579 X:152995865-152995887 CAGAAAAAAGAGAGAGAGAGAGG - Intergenic
1200445260 Y:3253958-3253980 CACAGCAACAAGAGAGAGAGCGG + Intergenic
1200635045 Y:5641511-5641533 CAGAAGAAAAAGAGAGAGATGGG + Intronic
1201140219 Y:11021790-11021812 TAGAGTGGAAAGAAATAGAGTGG - Intergenic
1201447685 Y:14076278-14076300 AAAAGAAAAAAGAAAGAGAGAGG - Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1201724179 Y:17135546-17135568 CAGAGCAAAGAGAGAGAGAGAGG + Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic
1201898217 Y:19016634-19016656 CAGAGCAAGAAGAGAGCGAGGGG + Intergenic
1202087015 Y:21148954-21148976 CAGAGGAAATAGAAAGGGATGGG + Intergenic
1202174918 Y:22089095-22089117 CAGAACTAAAAGAAATAGAGAGG + Intronic
1202216444 Y:22497287-22497309 CAGAACTAAAAGAAATAGAGAGG - Intronic
1202326743 Y:23698782-23698804 CAGAACTAAAAGAAATAGAGAGG + Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic
1202544026 Y:25971271-25971293 CAGAACTAAAAGAAATAGAGAGG - Intergenic