ID: 921239400

View in Genome Browser
Species Human (GRCh38)
Location 1:213162571-213162593
Sequence ATAACATTGCTGGCCAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921239400_921239404 3 Left 921239400 1:213162571-213162593 CCATACTTGGCCAGCAATGTTAT 0: 1
1: 0
2: 2
3: 18
4: 217
Right 921239404 1:213162597-213162619 GAAGGGAGTAAATAAGTCTTTGG 0: 1
1: 0
2: 0
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921239400 Original CRISPR ATAACATTGCTGGCCAAGTA TGG (reversed) Intronic
903478432 1:23636244-23636266 ATGGGATTGCTGGCCAAGAAGGG + Intronic
905042992 1:34976041-34976063 AGATCATTCCTGGCCAAGTCAGG + Intergenic
905600400 1:39245001-39245023 ATAAAACTACTGGCCAAGCACGG - Intronic
905730626 1:40296890-40296912 TTAAAATTGCTGGCCAGGCACGG - Intergenic
906010319 1:42517371-42517393 ATAACACTACTGGCCAAGTGTGG - Intronic
907022128 1:51078196-51078218 ATAACATTTCAGGCCAGGCATGG - Intergenic
907361363 1:53918401-53918423 AGAACATTGTTGGTCAATTACGG + Intronic
908269172 1:62406420-62406442 ACAACCTTCCTGGCCAAGTAGGG + Intergenic
908388605 1:63665378-63665400 TTAACATTGTTGGCCAGGTTAGG - Intergenic
912687082 1:111776096-111776118 ACAACATTGCTGGCTATGGAAGG + Exonic
914221655 1:145687227-145687249 ATAAAATTGCTGGCCGAGCGTGG + Intronic
914510860 1:148330635-148330657 ATACAATTGATGGCCAAGTGGGG - Intergenic
914777462 1:150750930-150750952 AAAACATAGTTGGCCAAGTGTGG - Intronic
914785917 1:150830570-150830592 AAAACTATGCTGGCCAAATATGG + Intronic
915231686 1:154450412-154450434 AGAACATTTCTGGCCAGGCACGG - Intronic
916915176 1:169399080-169399102 ATAACCTTGCTGGCCATGGTAGG + Intronic
918124892 1:181574734-181574756 ATTCCATTGTTGGCCAGGTATGG + Intronic
921125702 1:212175950-212175972 ATAATACTGCTGGCCAGGTGCGG - Intergenic
921239400 1:213162571-213162593 ATAACATTGCTGGCCAAGTATGG - Intronic
921640162 1:217543557-217543579 AAAACATTCCTGGCCAGGTGTGG - Intronic
922295086 1:224243070-224243092 ATAAAATTACTGGCCAGGTACGG - Intronic
922488050 1:225991727-225991749 AAAACATGGCAGGCCTAGTATGG - Intronic
922521596 1:226257238-226257260 TTAACATTTCTGGCCAGGTGTGG - Intronic
923004931 1:230040940-230040962 ATAACATTTCTTCCCAAGTGAGG + Intergenic
1066410537 10:35164541-35164563 AAAACATTGCTGGCCACTTTGGG + Intronic
1067264149 10:44722535-44722557 AAAACGTTGCTGGCCAGGTGCGG - Intergenic
1068691023 10:59914384-59914406 AAAAAATTGCTGGCCAGGCAAGG + Intergenic
1071842531 10:89487508-89487530 AAGAAATTGTTGGCCAAGTATGG + Intronic
1073157763 10:101361394-101361416 AAAATATTGCTGGCCAGGTGCGG - Intronic
1073298860 10:102458447-102458469 ACAAGATTGCTGGCCAGGTGCGG - Intergenic
1073558594 10:104478164-104478186 ATAGGATTACTGGCCAAATAAGG - Intergenic
1073726198 10:106234005-106234027 ATAATATTACTTGCCAGGTATGG + Intergenic
1074812960 10:117123919-117123941 AAAAAATTGCTGGCCAGGCACGG + Intronic
1079190781 11:18275152-18275174 ATACAATTGCTGGCCAGGCATGG - Intergenic
1080307732 11:30854599-30854621 AGAACACTGCTGGCCGAGCACGG - Intronic
1080799055 11:35592617-35592639 AAACCATTGCTGGCCAGGCACGG + Intergenic
1082629886 11:55529714-55529736 ATAACACTGGTGGCCCAGCATGG + Intergenic
1083335958 11:61921896-61921918 ATAACATTTGTGGCCAGGTGCGG + Intergenic
1085352376 11:75807415-75807437 ATAACATTCTTGGCCATGCATGG - Intergenic
1085427543 11:76418053-76418075 ATTACATTGCTGTCCCAGGATGG - Intergenic
1085835691 11:79954270-79954292 ATAAAATTGCTGGGCAAATAGGG - Intergenic
1088129935 11:106475413-106475435 ATGACCTTCCTGGCCAAGTAGGG + Intergenic
1090010550 11:123041972-123041994 AACGCAATGCTGGCCAAGTATGG - Intergenic
1091078416 11:132642969-132642991 ATCACATTGCTGGCCACTGAGGG - Intronic
1093645484 12:21581322-21581344 ATAACATAACTGGCCAGGTCAGG - Intronic
1093739555 12:22667672-22667694 CTAACATTGCAGAGCAAGTAGGG + Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1097277959 12:57826018-57826040 TTAACAGTGCTGGCCACGTGAGG + Intronic
1099211159 12:79790157-79790179 AATACATTTCTGGCCAAGTGTGG + Intronic
1099865239 12:88272099-88272121 AAAACAGTTCTGGCCAGGTATGG + Intergenic
1101604421 12:106237235-106237257 ATACCAGTGCTGGCCAGGCATGG + Intergenic
1105549587 13:21380501-21380523 ATAACACTGCTGGCCGGGCATGG + Intronic
1105936050 13:25100332-25100354 GTAAGATTGCTGGCCAGGCATGG - Intergenic
1106672013 13:31916253-31916275 CTGACATTGCAGGTCAAGTAGGG + Intergenic
1106688516 13:32088301-32088323 AAAACATTGCTGGTCAGATAGGG + Intronic
1107280557 13:38728701-38728723 ATAACAGTGTTAGCCAGGTACGG - Intronic
1107463426 13:40627540-40627562 ATAACTTTCCTGGCCAAGCGTGG + Intronic
1107773610 13:43814286-43814308 AGAACATTGCTGGACAACCATGG + Intergenic
1108448980 13:50541370-50541392 ATAACAATGATGGCCAGGTACGG + Intronic
1113121488 13:106928116-106928138 TAAACATTGCTGGCCAGGTGTGG - Intergenic
1117515749 14:56499663-56499685 ATAACATTGCTAGCCAAAAGGGG + Intronic
1117534223 14:56688621-56688643 ATTGCATAGGTGGCCAAGTAAGG - Intronic
1117737541 14:58782870-58782892 AGAACATTGCAGGCCAGGGAAGG + Intergenic
1118514874 14:66516306-66516328 ATATAATTGCTGGCCAGGCACGG - Intronic
1120185427 14:81388885-81388907 ATAAAACAGCTGGCTAAGTAAGG + Intronic
1120936338 14:89898962-89898984 AGAAAATTGCAGGCCAAGCATGG - Intronic
1121994537 14:98592117-98592139 ATAGCATTGCTGGCCAGGTGTGG - Intergenic
1124427782 15:29577095-29577117 ATAATATAGCTGGCCAGGTCTGG - Intergenic
1124551616 15:30686094-30686116 ATGACAGTGCTGGGCAAGGATGG + Intronic
1125917434 15:43501502-43501524 ATCAAATTACTGGCCAAGCACGG - Intronic
1126565333 15:50090876-50090898 ATCACATTTCAGGCCAAGTGAGG - Intronic
1126711454 15:51461539-51461561 ATAAGATTTCTGGTCAATTAGGG - Intronic
1126937396 15:53726549-53726571 ATATCGATGCTGGCCAAGCATGG + Intronic
1128433848 15:67626227-67626249 ATCACATTTCAGGCCAAGTGTGG + Intronic
1128483731 15:68064137-68064159 AAAAAATGGCTGGCAAAGTATGG + Intronic
1129602071 15:77005091-77005113 TTACCATTGCTGGCCAAGCATGG + Intronic
1129640998 15:77377758-77377780 ATAACATTGTTGGCCTGGCATGG - Intronic
1130575334 15:85087488-85087510 ATAACAATGCTGGCCAGGCACGG - Intronic
1130989061 15:88864773-88864795 ATAACTTTCCTGGGCAAGGATGG - Intronic
1132340351 15:101074344-101074366 AGAAAATTGCTGGGCAGGTAGGG - Intronic
1134262702 16:12665499-12665521 ATAACATTTATGGCCAGGGATGG + Intronic
1137450502 16:48569684-48569706 ATAGCATTGCAGGCCAGGCATGG - Intronic
1139957077 16:70698227-70698249 ATAACCTTGCTGGCGAATCAGGG - Intronic
1140065549 16:71608138-71608160 ATAACATTCCAGGCCAGGCACGG - Intergenic
1140809138 16:78560350-78560372 ATAACATTAGTGGCCAGGTGCGG + Intronic
1141207523 16:81944764-81944786 ATGACATAGTTGGCCAAGTACGG - Intronic
1141372135 16:83497748-83497770 AGACCAGTGCTGGCCAACTATGG - Intronic
1142484954 17:241096-241118 ATAATCTTGTTGGCCAAGGATGG + Intronic
1147487562 17:40832191-40832213 ATAAAATTTCTGGCCAAGGGTGG - Intronic
1148517440 17:48233562-48233584 ATAAGATTACTGGCCAAGTGTGG + Intronic
1150557396 17:66266725-66266747 TCAACATGACTGGCCAAGTAGGG - Intergenic
1150560589 17:66291050-66291072 ATGACAATGTTGGCTAAGTATGG - Intergenic
1150560800 17:66293154-66293176 ATAACTATGTTGGCTAAGTATGG - Intergenic
1151929359 17:77221822-77221844 ACAATTTTGCTGGCCAAGCATGG - Intergenic
1153137860 18:1937920-1937942 ATGACATTGCTGGGTAAGAATGG + Intergenic
1155136087 18:22994350-22994372 AAAACATTGTTGGCCCGGTACGG + Intronic
1156216036 18:34998816-34998838 TTAACATTTTTGGCCAAGTCCGG - Intronic
1156398901 18:36723279-36723301 ATAAAATTTCTTGCCAGGTAAGG - Intronic
1162636978 19:11976574-11976596 AAAAAATTGCTGGCCAGGTGTGG + Intronic
1165557943 19:36652199-36652221 ATAAAATTTCTGGCCAGGCACGG + Intronic
1168376834 19:55886993-55887015 ATAACATGGTTGGCCAGGTTTGG + Intergenic
926418598 2:12675280-12675302 ATATCATTGCTGACCAAGATAGG - Intergenic
926902614 2:17771051-17771073 ATAAAGTTGCTGGCCTAGTGTGG - Intronic
927389554 2:22580016-22580038 AGAAGAATGCTGGCCAAGTGAGG + Intergenic
927915702 2:26934718-26934740 ATGAGCCTGCTGGCCAAGTAAGG + Exonic
929704645 2:44197407-44197429 TTAACATTAGTGGCCAAGTGTGG - Intronic
929958884 2:46480984-46481006 TTAACAGAGCTGGCCAGGTAGGG - Intronic
930131582 2:47857409-47857431 ATAAAATTTCTGGCCAGGTGTGG - Intronic
931753955 2:65355424-65355446 ATAAAATTTATGGCCAAGTGTGG + Intronic
932558255 2:72844290-72844312 ATTAGATTGCTGGCCAGGTGTGG - Intergenic
933377610 2:81499909-81499931 ATAACAATCCTGGCCAGGTGTGG - Intergenic
933466298 2:82657115-82657137 ATAACATTTCTAGCTATGTAAGG + Intergenic
935953933 2:108355674-108355696 AAAACATTGTTGGCCAGGTGCGG - Intergenic
935977968 2:108597980-108598002 ATAGCATTTCTGGCCAGGTGTGG - Intronic
936135584 2:109890574-109890596 ATAGCATTTCTGGCCAGGTGTGG - Intergenic
936209113 2:110480911-110480933 ATAGCATTTCTGGCCAGGTGTGG + Intergenic
939798173 2:146674045-146674067 ATAACAGTGCTGGCAAACTGGGG + Intergenic
940949905 2:159661899-159661921 ATAAGATTGTTGGCCAGGCATGG - Intergenic
941214301 2:162686465-162686487 ATACCATTACTTGCCAAGTTTGG - Intronic
941650011 2:168082413-168082435 ATAGCATTGGTGGCCTAGTAGGG - Intronic
944500754 2:200357325-200357347 TTAGCATTGCTGGCTAAGTGAGG + Intronic
945534094 2:210990179-210990201 ATGACATTACTGGCCAGGCATGG - Intergenic
946361953 2:219224232-219224254 TTGACACTGCTGGCCAAGAATGG - Exonic
946677723 2:222180211-222180233 ATAACATTACTGGCCAGGCATGG + Intergenic
946999070 2:225432284-225432306 CTATCATTGCTGGCCGGGTACGG - Intronic
947609900 2:231518149-231518171 ACAACACTGCTGGCCAGGCATGG - Intergenic
948210555 2:236190088-236190110 ATAACATTGCTGGCTGGGCATGG + Intergenic
948288598 2:236807448-236807470 ATAACATTGTTGGCCAAGCATGG + Intergenic
1170017333 20:11796725-11796747 ATTGCATTGCTGGGCATGTAGGG + Intergenic
1172905792 20:38368307-38368329 AAAGCATTGCTGGCCAGGTGCGG + Intronic
1172931404 20:38588793-38588815 ATACGATTGCTGGCCGAGCACGG + Intergenic
1173534476 20:43798933-43798955 ATAACATTGCAGGGCATGAAGGG - Intergenic
1173909880 20:46659424-46659446 ACAATAATGGTGGCCAAGTATGG + Intronic
1175559396 20:59907954-59907976 ATACCATTCCTGGCCAGGCACGG + Intronic
1178185858 21:30219494-30219516 ACAAGATGGTTGGCCAAGTATGG - Intergenic
1179129972 21:38626717-38626739 TTAACATTACTGGCTAAATAAGG + Intronic
1182038643 22:27219092-27219114 AAAACATTCCAGGCCAAGAAAGG - Intergenic
1182540232 22:31036038-31036060 ATAAAATTCCAGGCCAAGTGTGG + Intergenic
1183202064 22:36392188-36392210 AAAACATTTCTGGCCAGGCATGG + Intergenic
954082257 3:48219422-48219444 GTAACTTTGTTGGCCAAGCATGG - Intergenic
954279333 3:49564862-49564884 ATAACATGGCTGACCAGGAAAGG - Intronic
954470872 3:50693976-50693998 ACAAAATTGTTGGCCAAGTGTGG + Intronic
956337747 3:68183317-68183339 ATGACATTGCTGTCCAATCATGG - Intronic
956893927 3:73640600-73640622 AAAACAATTCTAGCCAAGTAGGG - Intergenic
960729097 3:120704753-120704775 ATACCATTTATGGCCAGGTATGG + Intronic
960987067 3:123287620-123287642 ATGGCATTGCTGACCAAGTGAGG - Intronic
961268177 3:125664790-125664812 ATGACATTACTGGCCAGGTATGG - Intergenic
962796599 3:138855046-138855068 AAAAAATTGTTGGCCAAGCATGG - Intergenic
968144918 3:196289895-196289917 ATAAAATTACTGGCCAGGTGTGG + Intronic
969794117 4:9512794-9512816 GAAACATTGCTGGCGATGTATGG + Intergenic
971034792 4:22681512-22681534 CAAACATTGTTGGCCAAGCACGG - Intergenic
975491530 4:74994516-74994538 AAAACAATGCTGGCCAGGCATGG + Intronic
977256694 4:94748893-94748915 ATCATATTGCTGGCCAGGCATGG - Intergenic
982156647 4:152529674-152529696 ATAGCAATGCTGGCCAGGTGTGG + Intronic
983643495 4:169966161-169966183 ATTGTATGGCTGGCCAAGTAAGG + Intergenic
987723801 5:21670848-21670870 AAAACAGTGCTGGCCAGGTGCGG - Intergenic
989025444 5:37062124-37062146 ATAACAGCACTGGCCAGGTATGG - Intronic
989469861 5:41803121-41803143 ATAAAATTGCTGGCCAGGAGAGG + Exonic
989594441 5:43142984-43143006 AAACCATGTCTGGCCAAGTATGG - Intronic
991399162 5:66235683-66235705 ATTACATTGCTGGCCTGGTGCGG + Intergenic
991590686 5:68248270-68248292 AGAACATTGTTGGCCAGGCATGG - Intronic
992113944 5:73521976-73521998 CCAGCATTGCTGGCCAGGTACGG + Intergenic
992303017 5:75404716-75404738 TTAAAAATTCTGGCCAAGTATGG + Intronic
993357755 5:86936248-86936270 ATACCGTTGATGGACAAGTAAGG - Intergenic
993638814 5:90377922-90377944 CTACCATGCCTGGCCAAGTACGG + Intergenic
993731705 5:91430347-91430369 ATAACATTGCAGGCCGGGTGTGG + Intergenic
993746328 5:91601838-91601860 AAAACACTGCAGGCCAAGTGTGG - Intergenic
996203777 5:120705308-120705330 ATAACATTTCTGGCAATGTTGGG - Intergenic
997313806 5:132915046-132915068 ATACCATTTCTGGCCAGGCACGG + Intronic
999117858 5:149179964-149179986 TTAACATTACTGGCCAATAAAGG - Intronic
999554734 5:152728200-152728222 AGAACATTGCTGGCCAGTCATGG + Intergenic
1000464667 5:161560895-161560917 ATAACATTGCTGATGAAGGATGG - Intronic
1001220636 5:169897477-169897499 CTCACATTCCTGGCCGAGTACGG - Intronic
1001774060 5:174315588-174315610 ATAACATGGCTGGCACAGAAAGG + Intergenic
1002514453 5:179746661-179746683 GTAACATTGCTGGCTAGGTGTGG - Intronic
1002539833 5:179899135-179899157 AGAACACTGCTGGCCAGGGAAGG + Intronic
1003836378 6:10076171-10076193 AAAAAATTGGTGGCCAAGCACGG + Intronic
1003912486 6:10754954-10754976 ATACCAATACTGGCCAAATAGGG - Intronic
1004632831 6:17438075-17438097 ATAACATTGCTGGCCAGGCGTGG + Intronic
1004926131 6:20416742-20416764 ATAACATTGCAGCCCAGTTACGG - Intronic
1008161308 6:48079532-48079554 ACAGCATCCCTGGCCAAGTAGGG + Intergenic
1008759067 6:54832258-54832280 ATAAGATTGCTGGCCAGGCACGG - Intergenic
1010288562 6:74108673-74108695 ATAAGATTCCAGGCCAAGTCAGG + Intergenic
1013722677 6:113049584-113049606 AAAACACTGCTGGCCAGGCATGG + Intergenic
1014768461 6:125434282-125434304 ATGACATTCCTGGTCAAGCAAGG + Intergenic
1016002762 6:139058890-139058912 ATAACATTTGTGGCCAGGTGTGG - Intergenic
1016701522 6:147059538-147059560 TTAACATTTCTGACAAAGTAAGG - Intergenic
1016840825 6:148523384-148523406 ATAACATTGCTTACCCAGTTAGG + Intronic
1017300887 6:152856234-152856256 ATCACATTATTGGCCAGGTATGG - Intergenic
1017833070 6:158149452-158149474 ATAAGATTGCTCTCCAAGTCAGG + Intronic
1017894823 6:158670489-158670511 TTAACATTGCTGGCCGGGCATGG + Intronic
1018311711 6:162516459-162516481 AAAACATTTCTGGCCAGGTGTGG + Intronic
1018428618 6:163705396-163705418 AAAAAATTGCTGGCCAGGTGCGG - Intergenic
1021904591 7:25320637-25320659 AGAACATTGCAGGGCACGTAGGG + Intergenic
1024134223 7:46390205-46390227 TTCCCATTGCTGGCCAAGGATGG + Intergenic
1024470356 7:49763546-49763568 ATGACAATGCTGGCCAGGTGGGG + Intergenic
1024830427 7:53448053-53448075 ATAACATTACTGGCTATTTAAGG + Intergenic
1030040663 7:105447149-105447171 AAAAAATTGCTGGCCAGGCACGG - Intronic
1033626318 7:143113225-143113247 AAAACATTGTGGGCCAGGTATGG + Intergenic
1034614424 7:152403216-152403238 ATAAAACTGCTGGCCAGGCACGG + Intronic
1036902939 8:12685218-12685240 GAAACATTGCTGGCGATGTATGG - Intergenic
1037341637 8:17851925-17851947 AGAACATTTCTGGCCAGGTGTGG - Intergenic
1037470426 8:19203310-19203332 ATAAAATTGTTGGCCAAAAATGG + Intergenic
1037885896 8:22596194-22596216 ATGACACTGCTGGCCCAGCATGG - Intronic
1038555543 8:28511059-28511081 ATAACATTGCCGGCAAGGTGCGG + Intronic
1039534342 8:38294685-38294707 ATATCATCTCTGGCCAAGTGTGG + Intronic
1039966118 8:42285144-42285166 ATAACATTTCTGGCCAGCCACGG - Intronic
1041061161 8:54035907-54035929 AAAAGAATGCTGGCCAAGTGCGG - Intergenic
1041954009 8:63537226-63537248 ACAACAGTGCAGGCCAAGTAAGG - Intergenic
1045291690 8:100838830-100838852 ATACCGTTGCTCGCCAAGAAAGG - Intergenic
1048330884 8:133470127-133470149 ACAACAGTGCTGGCCAGGTGCGG + Intronic
1049963519 9:758079-758101 AAAACATTGTTGGCCAGGCACGG - Intergenic
1050355422 9:4778395-4778417 ATAACATTATTGGCCAGGCATGG + Intergenic
1050533275 9:6608982-6609004 CTAAACTTGCTGACCAAGTATGG + Intronic
1051055447 9:12979551-12979573 ATGAAAATGCTGGCCAAGTGCGG - Intergenic
1052010737 9:23405838-23405860 ATTACATTGGTGGCAAAGTGGGG - Intergenic
1052545519 9:29872945-29872967 AAAACATTACTGACCATGTAAGG - Intergenic
1052734409 9:32325481-32325503 ATGACAATTCTGACCAAGTATGG - Intergenic
1052788056 9:32848241-32848263 ATACCATGGCTGGCCAAGCAAGG - Intergenic
1053169204 9:35866789-35866811 ATAAGATTCCTGGCCAGGCATGG + Intergenic
1054869055 9:70032428-70032450 GTGATATTGCTGGCCCAGTATGG + Intergenic
1055036662 9:71825147-71825169 AAAATAGTGCTGGCCAAGCACGG - Intergenic
1056137549 9:83645190-83645212 AAAACATTGCTTTTCAAGTAGGG + Intergenic
1056833281 9:89933591-89933613 AGAACATTGCATTCCAAGTAAGG + Intergenic
1058470091 9:105268786-105268808 AGAAAATTGTTGGCCAGGTACGG - Intronic
1060078272 9:120615550-120615572 ATAACATTGTTTACCACGTAAGG - Intronic
1061510903 9:131060351-131060373 ATAACAGTGCTGGCCGGGCACGG + Intronic
1185578004 X:1189253-1189275 ATAAGGTTGCTGGCCAGGCACGG + Intronic
1186965992 X:14786479-14786501 TTATCATTGCTTGCCAAGAATGG + Intergenic
1188540447 X:31244166-31244188 ATAAAATTGCTTGCTAAGAAGGG + Intronic
1188833162 X:34925796-34925818 ATTACATTTCTGGCCAGGCACGG - Intergenic
1189103112 X:38211409-38211431 ATACCATTGCTGGCCAGACACGG + Intronic
1189470368 X:41309161-41309183 TTAACATCACTGGCCAAGTCGGG - Intergenic
1189826794 X:44926905-44926927 ACACAATTACTGGCCAAGTAAGG - Intronic
1192985822 X:76397311-76397333 ATAACATTGCTGGCCAGGCATGG - Intergenic
1196029526 X:111081200-111081222 TAAAAATTGCTGGCCAGGTACGG + Intronic
1197921854 X:131603012-131603034 ATAAAAATGCTGGCCAGGCATGG - Intergenic
1198993872 X:142550027-142550049 ATAAAACTGCTTGCCAAATAAGG + Intergenic