ID: 921245286

View in Genome Browser
Species Human (GRCh38)
Location 1:213232390-213232412
Sequence CCTCCCTACTTTGAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921245283_921245286 -6 Left 921245283 1:213232373-213232395 CCTATTCCTCTGCTCTACCTCCC 0: 1
1: 0
2: 2
3: 52
4: 556
Right 921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG 0: 1
1: 0
2: 1
3: 13
4: 173
921245282_921245286 0 Left 921245282 1:213232367-213232389 CCATTTCCTATTCCTCTGCTCTA 0: 1
1: 0
2: 1
3: 50
4: 603
Right 921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921245286 Original CRISPR CCTCCCTACTTTGAGTTGTG AGG Intronic
900645548 1:3707163-3707185 TCTCCCCACTTTGAGCTGTGAGG + Intronic
901260352 1:7866247-7866269 CCTGCCTACTTTCAGCTGCGAGG - Intergenic
908417052 1:63923388-63923410 ACTCCGTTCTCTGAGTTGTGAGG + Intronic
908522646 1:64959033-64959055 GCTCCCTAATTTGATTTGTATGG - Intronic
910169546 1:84362694-84362716 CCTCCGGACTCTGAGCTGTGTGG - Intronic
910216021 1:84845453-84845475 CCTACCTGCTCTGAGTAGTGTGG - Intronic
911985952 1:104622015-104622037 CCTCCCCAGTTCGAGTTGTCTGG - Intergenic
912222940 1:107698940-107698962 CCTCCCTCCCTTGATATGTGGGG + Intronic
913485118 1:119327072-119327094 CCACCCCACCTTGTGTTGTGGGG + Intergenic
913674154 1:121125719-121125741 CCTCCCTACTTTGGCATTTGGGG + Intergenic
914025938 1:143913040-143913062 CCTCCCTACTTTGGCATTTGGGG + Intergenic
914327724 1:146636582-146636604 CCTCCCTACTTGCATATGTGGGG - Intergenic
914664375 1:149820760-149820782 CCTCCCTACTTTGGCATTTGGGG + Intergenic
914671388 1:149873075-149873097 CCTCCCTACTTTGGCATTTGGGG - Intronic
915785907 1:158611710-158611732 CCTGGCTGCTTTGAGATGTGGGG + Intronic
916485272 1:165253330-165253352 CCTCCCAACTCTAAATTGTGCGG + Intronic
916883751 1:169047324-169047346 CCACCCCACTTTGAGTTGACAGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG + Intronic
921324255 1:213975032-213975054 ACTCCCTACTATGAATTGTTAGG - Intergenic
922913269 1:229234966-229234988 CCTCCTCACTTCGAGTTGTCCGG + Intergenic
923961603 1:239090837-239090859 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1063078528 10:2741584-2741606 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1063093769 10:2890972-2890994 TCTCACTACTGTGAGGTGTGGGG - Intergenic
1063435576 10:6027019-6027041 CCTCCCTACCTTCAGTTCTTAGG - Intronic
1065957926 10:30709557-30709579 CCTCCCTCCTTTGGGTTTAGGGG - Intergenic
1066426686 10:35313614-35313636 TCTCCCTACTCTGAGTTGACTGG - Intronic
1069578043 10:69544689-69544711 CCTACTTTCTGTGAGTTGTGGGG + Intergenic
1072052059 10:91714621-91714643 GGTCCCTACTTTGACCTGTGAGG - Intergenic
1075086925 10:119419838-119419860 CCTCCCTTCTCTGAGCCGTGGGG + Intronic
1077443316 11:2578680-2578702 CCGCCCTCCTTGGAGCTGTGGGG + Intronic
1077493204 11:2871636-2871658 CCTCCCCACTTTGTTTTCTGGGG + Intergenic
1078179157 11:8996028-8996050 CCTACCTACTTTAAGTTGTATGG - Intronic
1081440347 11:43073977-43073999 CTTTCCTACTTTGAGATTTGGGG - Intergenic
1082761961 11:57136160-57136182 CCTCACTAGCTTGAGGTGTGTGG + Intergenic
1083270393 11:61569369-61569391 CCTCCCTTCTTCCAGTTCTGTGG - Intronic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1085336822 11:75702724-75702746 GTTCCCCACTTTGAGTTCTGTGG + Intergenic
1087731963 11:101789123-101789145 CTTCCCTACTTTGAGGTTTTGGG - Intronic
1090597746 11:128337129-128337151 CCTACCTAGTTTGAGTTGGATGG - Intergenic
1093484063 12:19634615-19634637 CCTCTCTAATTTGAGGTCTGGGG + Intronic
1095262517 12:40112983-40113005 CCTCCCTCCTTTGACACGTGGGG - Intergenic
1097897929 12:64844088-64844110 CCAGCCTACTTAGACTTGTGGGG + Intronic
1103600083 12:122049288-122049310 ACTCCCTATTTTGAGCTCTGTGG - Intronic
1106167306 13:27259666-27259688 CCTGGCTGCTTTGAGATGTGGGG + Intergenic
1106542068 13:30699007-30699029 CCTCTCCACTTGGAGTTGTCCGG - Intergenic
1108661363 13:52590220-52590242 CCTCCCTACTTCGTTTTATGAGG - Intergenic
1110022173 13:70489603-70489625 CCTCCCTCCTTTGACATGTGGGG - Intergenic
1110265167 13:73529368-73529390 CCTCCCTGCCTTGACATGTGGGG - Intergenic
1110852880 13:80264463-80264485 CCTCCCTCCTTTGACATGTGGGG + Intergenic
1111900501 13:94193835-94193857 CCTCCCTGCTTTTAATAGTGAGG + Intronic
1112609561 13:100943093-100943115 CCTGCCTATTTTGAGAGGTGTGG + Intergenic
1113045636 13:106151859-106151881 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1113150404 13:107257197-107257219 CCTCCCTCCCTTGACATGTGGGG + Intronic
1113168160 13:107466874-107466896 CCTCCCTATTTTGGAGTGTGTGG + Intronic
1113355315 13:109574129-109574151 CTTCCCTACTTTGGGGTGTGGGG - Intergenic
1117233412 14:53745780-53745802 TCTCCCTAATTTCAGTTGTCAGG + Intergenic
1119737883 14:76995546-76995568 CCTCCTTTCTGTGAGCTGTGGGG - Intergenic
1121979296 14:98440476-98440498 CTTCCCTCCCTTGACTTGTGAGG + Intergenic
1122433986 14:101679777-101679799 CCTCGTGACATTGAGTTGTGGGG - Intergenic
1126868751 15:52964759-52964781 GCTTCCTCCTTAGAGTTGTGAGG + Intergenic
1127020780 15:54745987-54746009 CTTCCCTACTTTGAGGTTTGGGG + Intergenic
1127103062 15:55587607-55587629 CCTCCCGACTTTGTGTTCGGAGG - Intronic
1127529792 15:59832703-59832725 CCTCCTTACTGTGATATGTGAGG + Intergenic
1130156609 15:81356265-81356287 CCTCCCTTCATTGAGTTATTTGG + Intronic
1131344946 15:91637747-91637769 CCGCCCTACTTTAAGTTCAGGGG + Intergenic
1131434465 15:92412079-92412101 CCTCCTTCCTTGGAATTGTGGGG + Intronic
1131512314 15:93056138-93056160 CCGGCCCACTTTGAGTAGTGAGG + Intronic
1132582682 16:692752-692774 CCTCCCCACTAGGGGTTGTGGGG + Exonic
1133955709 16:10442126-10442148 CCACCTTACTTTAAGTTGTTAGG - Intronic
1139188625 16:64836263-64836285 CCTCCCAGCTGTGAGGTGTGTGG - Intergenic
1140005834 16:71074354-71074376 CCTCCCTACTTGCATATGTGGGG + Intronic
1142685012 17:1572585-1572607 CCATCCTACTTTGCCTTGTGTGG - Intronic
1143527841 17:7482731-7482753 TCTCCCGAGTTGGAGTTGTGTGG + Exonic
1143958296 17:10692881-10692903 GCTCCCCAGTATGAGTTGTGAGG + Exonic
1144682439 17:17204845-17204867 CCTCCCTGCTCTGGGTGGTGTGG - Intronic
1144692127 17:17274198-17274220 TCTTCCAATTTTGAGTTGTGGGG + Intronic
1145255816 17:21321808-21321830 CCTCCCTCCTGTTAGCTGTGTGG + Intergenic
1146730917 17:35193539-35193561 CCTCCTGAGTTGGAGTTGTGTGG - Exonic
1147212510 17:38880092-38880114 CCTCCCTCCATTGGGTAGTGGGG + Intronic
1147880258 17:43648873-43648895 TCTCCCTGCCTTGAGCTGTGTGG + Intronic
1148197723 17:45726737-45726759 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1154115580 18:11610342-11610364 CCTCCTGAGTTGGAGTTGTGTGG + Intergenic
1154120027 18:11644557-11644579 CCTCCTGAGTTGGAGTTGTGTGG + Intergenic
1155560658 18:27072875-27072897 CCCCCATACTTTGAGTTGCAAGG - Intronic
1157011342 18:43652641-43652663 CCTCCCTCCCTTGACATGTGGGG + Intergenic
1158823518 18:61188371-61188393 TCTCCCTACTCTGACTTGAGTGG - Intergenic
1160517078 18:79484450-79484472 CCTCCCTACTCTGTGTAGGGCGG + Intronic
1166615629 19:44242468-44242490 CCTCCCCCTTTTAAGTTGTGAGG + Intronic
925884252 2:8380920-8380942 CCTCCCTACTTTGAGTCCCTGGG - Intergenic
926344032 2:11929393-11929415 CATCCCTACTTCTAGTTCTGGGG - Intergenic
927093761 2:19732028-19732050 CTTCCCTACTCTCAGTTCTGTGG + Intergenic
928105657 2:28469107-28469129 TCTCTTTGCTTTGAGTTGTGTGG + Intronic
928363371 2:30683524-30683546 CCTCCCTCCCTTGATGTGTGAGG + Intergenic
932238702 2:70141288-70141310 CCTCCCTACTGTGAAATGTGAGG + Intergenic
935085150 2:99837774-99837796 CCACCCTACTTTAAGTGGGGTGG + Intronic
935130419 2:100257215-100257237 CCTCCCTAATGTGAGGTGAGGGG - Intergenic
939088729 2:137753422-137753444 CCTCCTTATTTTGAGGTGTTGGG + Intergenic
939833768 2:147103427-147103449 CCTCCCTCCTTGCAGTTGTAGGG - Intergenic
940359853 2:152785982-152786004 CCTCCCTCCTTTGACACGTGGGG + Intergenic
940360162 2:152788312-152788334 CCTCCCTCCCTTGACGTGTGGGG + Intergenic
942886957 2:180937562-180937584 TCTCCCTCCTTTGACATGTGGGG - Intergenic
944626440 2:201574063-201574085 CCTCCCGACTTTGAGGTATGTGG - Intronic
945266158 2:207893309-207893331 CCTTCCTTCTTTGGGTTTTGGGG + Intronic
945574953 2:211518998-211519020 CCTTCCAACTTCCAGTTGTGAGG + Intronic
946844505 2:223847455-223847477 CCGCCCGCCTTTGAGTTGTCCGG - Intergenic
948110937 2:235455422-235455444 CCTCCATACTCTGCCTTGTGAGG - Intergenic
1170452404 20:16497639-16497661 CCTCCATACTTAAAGCTGTGGGG + Exonic
1172302242 20:33858322-33858344 CGTCCCTACTTGGAGCAGTGAGG - Intergenic
1174533865 20:51236127-51236149 CCTCCATGCTGGGAGTTGTGAGG + Intergenic
1174716533 20:52765140-52765162 CTTCCTTCCTTTGAGATGTGAGG - Intergenic
1175249442 20:57600310-57600332 CCTCCCTGCATCGAGTTCTGGGG + Intergenic
1177351157 21:19943823-19943845 CCTCCCTCCCTTGACATGTGGGG + Intergenic
1177880125 21:26683896-26683918 ACTTCCTACTTTGAGTACTGAGG - Intergenic
1178513285 21:33225476-33225498 CTTCCCTACTTTGAGCTTTTGGG - Intergenic
1179710869 21:43212251-43212273 CCTCCCAACCTCTAGTTGTGTGG + Intergenic
1181349441 22:22244719-22244741 CCTCCCTGCTCTGAGAGGTGGGG - Exonic
1181915095 22:26273572-26273594 CCTCCATTCTTTGAGTTGTGGGG - Intronic
1182820040 22:33207830-33207852 ACTCCCTAGTTTGACTTGGGTGG + Intronic
950920054 3:16685077-16685099 CCTCCCTCCCTTGACATGTGGGG + Intergenic
951636180 3:24780141-24780163 CCTCCCTCCCTTGACATGTGGGG + Intergenic
951814993 3:26744575-26744597 CCTCCCTCCCTTGACATGTGGGG + Intergenic
952930176 3:38353917-38353939 CCTCCATGATTTGAGATGTGAGG + Intronic
953604701 3:44404186-44404208 ACTCCATGCTTCGAGTTGTGTGG - Intronic
956020916 3:64932351-64932373 GCTCCCTCCTGTGAGTTTTGTGG + Intergenic
956891999 3:73622648-73622670 CCTCCCAACTAAGAGTTATGGGG + Intronic
958025502 3:88043922-88043944 CCTCCCTAATGTGGGGTGTGGGG - Intergenic
963018106 3:140844953-140844975 CCTCCCTCCCTTGACATGTGGGG + Intergenic
963545879 3:146658145-146658167 GCTCCCTGCTTGGGGTTGTGAGG + Intergenic
963922710 3:150921447-150921469 CCTCCCTCACTTCAGTTGTGTGG + Intronic
967366027 3:188687387-188687409 CCTCCCTCCCTTGACATGTGGGG - Intronic
971039320 4:22733866-22733888 CCTCCCTCCCTTGATGTGTGGGG - Intergenic
972192827 4:36615617-36615639 CCTCCATATTTTGACATGTGGGG + Intergenic
974473202 4:62345557-62345579 TCTCCCTACATAGTGTTGTGGGG + Intergenic
976545939 4:86335890-86335912 CCTCCCTCCCTTGACATGTGGGG + Intronic
976703688 4:87999533-87999555 CCTCCCTCCCTTGACATGTGGGG + Intergenic
981024044 4:140057944-140057966 CCACCTTTCTCTGAGTTGTGGGG + Intronic
983205507 4:164906479-164906501 CCTCCATTTTTTTAGTTGTGCGG - Intergenic
984603247 4:181753384-181753406 CCTGCCTGTTTTGAGTTATGGGG - Intergenic
986800033 5:11249572-11249594 CCAGGCTACTGTGAGTTGTGTGG + Intronic
988769251 5:34414881-34414903 CCTCCCTGCTTCAAGTTGTCTGG + Intergenic
989791065 5:45402481-45402503 CCTCCCAATTTTTTGTTGTGAGG - Intronic
990165240 5:52987463-52987485 CCTGCCTAGTTGCAGTTGTGAGG - Intergenic
990649136 5:57878430-57878452 CCTCCCTACCTTTATTTGAGAGG + Intergenic
990989918 5:61674714-61674736 CCTCCCTAAGTTGAGGTGAGGGG - Intronic
991178926 5:63725856-63725878 CCTCCCTCCCTTGACCTGTGGGG + Intergenic
991354587 5:65754688-65754710 CCTCCTTACTTTGTGGTATGGGG - Intronic
993565909 5:89475198-89475220 CATCGCCACTTTTAGTTGTGTGG - Intergenic
997837605 5:137208383-137208405 TCTCCCATCTATGAGTTGTGTGG - Intronic
999936730 5:156494759-156494781 CCTCCCTACCTTGTGTAGAGGGG + Intronic
1002044395 5:176533771-176533793 CGTCCCAACTTTGAGTTGAGCGG - Intronic
1005857801 6:29876165-29876187 TCTCCCTTCTTTGATTTGTAAGG + Intergenic
1005948890 6:30616650-30616672 CCTCCCTAAATGGAGTTGGGTGG - Exonic
1007021660 6:38527406-38527428 CCTCCCTCCCTTGACATGTGGGG - Intronic
1007096853 6:39218575-39218597 CCTCCCTTCTATGACTTTTGTGG - Intronic
1007847734 6:44774325-44774347 CCTCCCTCCCTCGACTTGTGGGG - Intergenic
1010189030 6:73175743-73175765 GATCCCTGCTTAGAGTTGTGAGG + Intronic
1011346489 6:86374715-86374737 GGTCCCAACTTTGACTTGTGGGG + Intergenic
1012070685 6:94611358-94611380 CCTCCCTAATTTGTTTTATGTGG + Intergenic
1014908143 6:127055815-127055837 CTTCCCTACTTTGAGGTTTTCGG - Intergenic
1019822935 7:3259477-3259499 CCTCCCTACTTTGAGTCATCTGG - Intergenic
1021717600 7:23473934-23473956 CCTCCCCACTGTGAGCCGTGAGG - Intergenic
1024565095 7:50674070-50674092 CGTCCCTACTCTGGGTAGTGAGG + Intronic
1024828933 7:53425508-53425530 AGTCCCTACTTGGAGTTGTGGGG - Intergenic
1024846989 7:53657244-53657266 CCTCACTACTTGGAGTTGGGGGG - Intergenic
1026200376 7:68209272-68209294 CCTCCCCACTTCGAGTTGCCTGG - Intergenic
1026509655 7:71017485-71017507 CCACCTCACTTTGAGTTGTCCGG + Intergenic
1028119992 7:87046576-87046598 CCTCCCTCCCTTGACATGTGGGG - Intronic
1030600306 7:111584447-111584469 CCTGCCTACATGGAGGTGTGGGG + Intergenic
1031780734 7:125960377-125960399 CCGCCGTACTTTAAGATGTGAGG + Intergenic
1032266620 7:130374235-130374257 CCCCCCGAGTTTGAGATGTGGGG - Intergenic
1032379187 7:131458242-131458264 CTTCCTAACTTTGAGATGTGAGG + Intronic
1032489842 7:132316206-132316228 CCTCCCTATGTTGTGTTGGGAGG + Intronic
1036737617 8:11331853-11331875 CCTCCTGAGTTGGAGTTGTGTGG + Exonic
1039559842 8:38504127-38504149 CCTCCCTGCTCTGAGTCCTGAGG - Intergenic
1040309120 8:46227534-46227556 CCTCCCTGTTTTCACTTGTGGGG - Intergenic
1040721625 8:50330897-50330919 CCTCCCTCCCTTGACATGTGAGG + Intronic
1043492363 8:80762550-80762572 CCTCCCTCCCTTGACATGTGGGG + Intronic
1044429858 8:92095804-92095826 CCTCCCTTCTTTGGGTGGTAGGG - Intronic
1046955558 8:120059652-120059674 CCTCCCTCTTTTGAAATGTGGGG - Intergenic
1049237536 8:141519526-141519548 CCTCCCTGCTTGGTGTTCTGTGG - Intergenic
1058074144 9:100633821-100633843 CCTGTCTATTTTGATTTGTGGGG + Intergenic
1058626835 9:106942289-106942311 CCTCCCTCCTCTGGGTTGGGAGG - Intronic
1062511838 9:136910564-136910586 CCTCCCTTGTTGGAGGTGTGAGG + Intronic
1193809839 X:86038378-86038400 CCTCCCCACTTCGAGTTGTCTGG + Intronic
1194087967 X:89552374-89552396 CCTCCCTCCGTTGACATGTGGGG + Intergenic
1195974708 X:110513875-110513897 CCTCTCTCCCTTGAGATGTGGGG + Intergenic
1200440654 Y:3208427-3208449 CCTCCCTCCGTTGACATGTGGGG - Intergenic