ID: 921251620

View in Genome Browser
Species Human (GRCh38)
Location 1:213303563-213303585
Sequence CAGGGTACGGAACGTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921251620_921251629 11 Left 921251620 1:213303563-213303585 CCCCAAGCACGTTCCGTACCCTG No data
Right 921251629 1:213303597-213303619 CCTGACAAAGGCGCGAGTGTAGG No data
921251620_921251627 -1 Left 921251620 1:213303563-213303585 CCCCAAGCACGTTCCGTACCCTG No data
Right 921251627 1:213303585-213303607 GGCTGTGTTTCTCCTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921251620 Original CRISPR CAGGGTACGGAACGTGCTTG GGG (reversed) Intergenic
No off target data available for this crispr