ID: 921251923

View in Genome Browser
Species Human (GRCh38)
Location 1:213306267-213306289
Sequence ATGTGATCCTCTGTATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921251922_921251923 -8 Left 921251922 1:213306252-213306274 CCAGGGATCAGGAAAATGTGATC No data
Right 921251923 1:213306267-213306289 ATGTGATCCTCTGTATGTCCAGG No data
921251920_921251923 5 Left 921251920 1:213306239-213306261 CCTCACTTAATTGCCAGGGATCA No data
Right 921251923 1:213306267-213306289 ATGTGATCCTCTGTATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921251923 Original CRISPR ATGTGATCCTCTGTATGTCC AGG Intergenic
No off target data available for this crispr