ID: 921252793

View in Genome Browser
Species Human (GRCh38)
Location 1:213313237-213313259
Sequence CTATCTGCCTTGAAGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921252793_921252798 3 Left 921252793 1:213313237-213313259 CCTTCAGCCTTCAAGGCAGATAG No data
Right 921252798 1:213313263-213313285 GCCACCAATCCGCCCAGAGGAGG No data
921252793_921252805 18 Left 921252793 1:213313237-213313259 CCTTCAGCCTTCAAGGCAGATAG No data
Right 921252805 1:213313278-213313300 AGAGGAGGCAACTCTCAGAAGGG No data
921252793_921252804 17 Left 921252793 1:213313237-213313259 CCTTCAGCCTTCAAGGCAGATAG No data
Right 921252804 1:213313277-213313299 CAGAGGAGGCAACTCTCAGAAGG No data
921252793_921252797 0 Left 921252793 1:213313237-213313259 CCTTCAGCCTTCAAGGCAGATAG No data
Right 921252797 1:213313260-213313282 GTGGCCACCAATCCGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921252793 Original CRISPR CTATCTGCCTTGAAGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr