ID: 921256855

View in Genome Browser
Species Human (GRCh38)
Location 1:213349389-213349411
Sequence CACAGTAAGGAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921256849_921256855 26 Left 921256849 1:213349340-213349362 CCAGGGCTGACGTGGGGGACGGT No data
Right 921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG No data
921256852_921256855 -6 Left 921256852 1:213349372-213349394 CCACTTGGGCAATTCAGCACAGT No data
Right 921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921256855 Original CRISPR CACAGTAAGGAGAAGCAGGA TGG Intergenic
No off target data available for this crispr