ID: 921257263

View in Genome Browser
Species Human (GRCh38)
Location 1:213353917-213353939
Sequence CAGCCTGAGCAAAGGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921257256_921257263 28 Left 921257256 1:213353866-213353888 CCTATGCTGTGTTCAGAGACATG No data
Right 921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG No data
921257255_921257263 29 Left 921257255 1:213353865-213353887 CCCTATGCTGTGTTCAGAGACAT No data
Right 921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921257263 Original CRISPR CAGCCTGAGCAAAGGCACAG AGG Intergenic
No off target data available for this crispr