ID: 921259319

View in Genome Browser
Species Human (GRCh38)
Location 1:213371728-213371750
Sequence TATGTTATGCAGAAGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921259319_921259325 0 Left 921259319 1:213371728-213371750 CCCTGCCACTTCTGCATAACATA No data
Right 921259325 1:213371751-213371773 AACCTGCTGGGCCAAGGCAGTGG No data
921259319_921259328 15 Left 921259319 1:213371728-213371750 CCCTGCCACTTCTGCATAACATA No data
Right 921259328 1:213371766-213371788 GGCAGTGGCCTGCACTGAAATGG No data
921259319_921259330 17 Left 921259319 1:213371728-213371750 CCCTGCCACTTCTGCATAACATA No data
Right 921259330 1:213371768-213371790 CAGTGGCCTGCACTGAAATGGGG No data
921259319_921259329 16 Left 921259319 1:213371728-213371750 CCCTGCCACTTCTGCATAACATA No data
Right 921259329 1:213371767-213371789 GCAGTGGCCTGCACTGAAATGGG No data
921259319_921259332 23 Left 921259319 1:213371728-213371750 CCCTGCCACTTCTGCATAACATA No data
Right 921259332 1:213371774-213371796 CCTGCACTGAAATGGGGCACAGG No data
921259319_921259324 -6 Left 921259319 1:213371728-213371750 CCCTGCCACTTCTGCATAACATA No data
Right 921259324 1:213371745-213371767 AACATAAACCTGCTGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921259319 Original CRISPR TATGTTATGCAGAAGTGGCA GGG (reversed) Intergenic
No off target data available for this crispr