ID: 921261460

View in Genome Browser
Species Human (GRCh38)
Location 1:213388469-213388491
Sequence AATTGCATGAAGAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921261460_921261466 27 Left 921261460 1:213388469-213388491 CCTCCCACATTCTTCATGCAATT No data
Right 921261466 1:213388519-213388541 CGATTTTGGGAACCTGACTCTGG No data
921261460_921261463 13 Left 921261460 1:213388469-213388491 CCTCCCACATTCTTCATGCAATT No data
Right 921261463 1:213388505-213388527 GCATAGCCAAGTATCGATTTTGG No data
921261460_921261464 14 Left 921261460 1:213388469-213388491 CCTCCCACATTCTTCATGCAATT No data
Right 921261464 1:213388506-213388528 CATAGCCAAGTATCGATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921261460 Original CRISPR AATTGCATGAAGAATGTGGG AGG (reversed) Intergenic
No off target data available for this crispr