ID: 921262067

View in Genome Browser
Species Human (GRCh38)
Location 1:213393480-213393502
Sequence TCCTGCATGCTGCTGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921262063_921262067 24 Left 921262063 1:213393433-213393455 CCCCTTGCTGTTATGGAGTTTTT No data
Right 921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG No data
921262062_921262067 27 Left 921262062 1:213393430-213393452 CCTCCCCTTGCTGTTATGGAGTT No data
Right 921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG No data
921262064_921262067 23 Left 921262064 1:213393434-213393456 CCCTTGCTGTTATGGAGTTTTTA No data
Right 921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG No data
921262065_921262067 22 Left 921262065 1:213393435-213393457 CCTTGCTGTTATGGAGTTTTTAA No data
Right 921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921262067 Original CRISPR TCCTGCATGCTGCTGCTCAC AGG Intergenic
No off target data available for this crispr