ID: 921262509

View in Genome Browser
Species Human (GRCh38)
Location 1:213396506-213396528
Sequence GGCCGTCCACACGTGTTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921262509_921262520 13 Left 921262509 1:213396506-213396528 CCACCGAACACGTGTGGACGGCC No data
Right 921262520 1:213396542-213396564 CTTCCCTGTACTAGTGTCAGGGG No data
921262509_921262519 12 Left 921262509 1:213396506-213396528 CCACCGAACACGTGTGGACGGCC No data
Right 921262519 1:213396541-213396563 CCTTCCCTGTACTAGTGTCAGGG No data
921262509_921262517 11 Left 921262509 1:213396506-213396528 CCACCGAACACGTGTGGACGGCC No data
Right 921262517 1:213396540-213396562 CCCTTCCCTGTACTAGTGTCAGG No data
921262509_921262521 14 Left 921262509 1:213396506-213396528 CCACCGAACACGTGTGGACGGCC No data
Right 921262521 1:213396543-213396565 TTCCCTGTACTAGTGTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921262509 Original CRISPR GGCCGTCCACACGTGTTCGG TGG (reversed) Intergenic