ID: 921265015

View in Genome Browser
Species Human (GRCh38)
Location 1:213414962-213414984
Sequence GGGTGGGTGTGGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921265004_921265015 0 Left 921265004 1:213414939-213414961 CCCCTGGGATTGCTGATTCTTTG No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921264997_921265015 30 Left 921264997 1:213414909-213414931 CCCCACACAGTGGTGCTCTACCC No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921265003_921265015 9 Left 921265003 1:213414930-213414952 CCAATGAGACCCCTGGGATTGCT No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921265007_921265015 -2 Left 921265007 1:213414941-213414963 CCTGGGATTGCTGATTCTTTGGG No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921264999_921265015 28 Left 921264999 1:213414911-213414933 CCACACAGTGGTGCTCTACCCAA No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921264998_921265015 29 Left 921264998 1:213414910-213414932 CCCACACAGTGGTGCTCTACCCA No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921265002_921265015 10 Left 921265002 1:213414929-213414951 CCCAATGAGACCCCTGGGATTGC No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data
921265005_921265015 -1 Left 921265005 1:213414940-213414962 CCCTGGGATTGCTGATTCTTTGG No data
Right 921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921265015 Original CRISPR GGGTGGGTGTGGAGGCCAGA GGG Intergenic
No off target data available for this crispr