ID: 921265454

View in Genome Browser
Species Human (GRCh38)
Location 1:213417561-213417583
Sequence GCGGCTGGAGGGAGGCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921265444_921265454 7 Left 921265444 1:213417531-213417553 CCTGGGGGAAAGCCAGTGGGGGC No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data
921265437_921265454 14 Left 921265437 1:213417524-213417546 CCCAGACCCTGGGGGAAAGCCAG No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data
921265436_921265454 15 Left 921265436 1:213417523-213417545 CCCCAGACCCTGGGGGAAAGCCA No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data
921265442_921265454 8 Left 921265442 1:213417530-213417552 CCCTGGGGGAAAGCCAGTGGGGG No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data
921265449_921265454 -5 Left 921265449 1:213417543-213417565 CCAGTGGGGGCTCGGGGTGCGGC No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data
921265435_921265454 16 Left 921265435 1:213417522-213417544 CCCCCAGACCCTGGGGGAAAGCC No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data
921265438_921265454 13 Left 921265438 1:213417525-213417547 CCAGACCCTGGGGGAAAGCCAGT No data
Right 921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921265454 Original CRISPR GCGGCTGGAGGGAGGCAATG TGG Intergenic
No off target data available for this crispr