ID: 921265962

View in Genome Browser
Species Human (GRCh38)
Location 1:213420831-213420853
Sequence CTGCATGTTCAGAGGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921265962_921265971 13 Left 921265962 1:213420831-213420853 CCACGCTCCCTCTGAACATGCAG No data
Right 921265971 1:213420867-213420889 CACGCCTCTCTCCTGGCTTCTGG No data
921265962_921265968 6 Left 921265962 1:213420831-213420853 CCACGCTCCCTCTGAACATGCAG No data
Right 921265968 1:213420860-213420882 CCCCATGCACGCCTCTCTCCTGG No data
921265962_921265974 24 Left 921265962 1:213420831-213420853 CCACGCTCCCTCTGAACATGCAG No data
Right 921265974 1:213420878-213420900 CCTGGCTTCTGGTGCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921265962 Original CRISPR CTGCATGTTCAGAGGGAGCG TGG (reversed) Intergenic
No off target data available for this crispr