ID: 921266338

View in Genome Browser
Species Human (GRCh38)
Location 1:213423777-213423799
Sequence TGGGGAAGGCAGGCCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921266319_921266338 20 Left 921266319 1:213423734-213423756 CCTTTAAAGTGGGAGCCTTGGAG No data
Right 921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG No data
921266327_921266338 5 Left 921266327 1:213423749-213423771 CCTTGGAGGGGGAGCGGCAGGGG No data
Right 921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG No data
921266316_921266338 30 Left 921266316 1:213423724-213423746 CCTTATTTTGCCTTTAAAGTGGG No data
Right 921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921266338 Original CRISPR TGGGGAAGGCAGGCCCAGAG GGG Intergenic
No off target data available for this crispr