ID: 921269298

View in Genome Browser
Species Human (GRCh38)
Location 1:213452907-213452929
Sequence CTGGCTGGTTCCGCTTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921269294_921269298 7 Left 921269294 1:213452877-213452899 CCTTGTATGATTTGTACAGGACA No data
Right 921269298 1:213452907-213452929 CTGGCTGGTTCCGCTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921269298 Original CRISPR CTGGCTGGTTCCGCTTTGCT TGG Intergenic
No off target data available for this crispr