ID: 921273584

View in Genome Browser
Species Human (GRCh38)
Location 1:213494135-213494157
Sequence GTCCCAACCATTTCTGTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921273584_921273586 3 Left 921273584 1:213494135-213494157 CCGGCTACAGAAATGGTTGGGAC No data
Right 921273586 1:213494161-213494183 GTTGTCACACACTTGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921273584 Original CRISPR GTCCCAACCATTTCTGTAGC CGG (reversed) Intergenic
No off target data available for this crispr