ID: 921274084

View in Genome Browser
Species Human (GRCh38)
Location 1:213500292-213500314
Sequence CAAAATGAAGATGGTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921274084_921274088 -10 Left 921274084 1:213500292-213500314 CCAATATCACCATCTTCATTTTG No data
Right 921274088 1:213500305-213500327 CTTCATTTTGCCCCACTGGAGGG No data
921274084_921274089 -1 Left 921274084 1:213500292-213500314 CCAATATCACCATCTTCATTTTG No data
Right 921274089 1:213500314-213500336 GCCCCACTGGAGGGTCTTCAAGG No data
921274084_921274091 0 Left 921274084 1:213500292-213500314 CCAATATCACCATCTTCATTTTG No data
Right 921274091 1:213500315-213500337 CCCCACTGGAGGGTCTTCAAGGG No data
921274084_921274095 20 Left 921274084 1:213500292-213500314 CCAATATCACCATCTTCATTTTG No data
Right 921274095 1:213500335-213500357 GGGCAATAGCACTAACGGCGCGG No data
921274084_921274094 15 Left 921274084 1:213500292-213500314 CCAATATCACCATCTTCATTTTG No data
Right 921274094 1:213500330-213500352 TTCAAGGGCAATAGCACTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921274084 Original CRISPR CAAAATGAAGATGGTGATAT TGG (reversed) Intergenic
No off target data available for this crispr