ID: 921278707

View in Genome Browser
Species Human (GRCh38)
Location 1:213544533-213544555
Sequence GGGAACACACAGAGGGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921278707_921278720 22 Left 921278707 1:213544533-213544555 CCGTGGCCCCTCTGTGTGTTCCC No data
Right 921278720 1:213544578-213544600 CCTGCCATGGAGCTACATATAGG No data
921278707_921278716 9 Left 921278707 1:213544533-213544555 CCGTGGCCCCTCTGTGTGTTCCC No data
Right 921278716 1:213544565-213544587 CTTGGCCTATCTCCCTGCCATGG No data
921278707_921278712 -9 Left 921278707 1:213544533-213544555 CCGTGGCCCCTCTGTGTGTTCCC No data
Right 921278712 1:213544547-213544569 TGTGTTCCCTCTTGGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921278707 Original CRISPR GGGAACACACAGAGGGGCCA CGG (reversed) Intergenic
No off target data available for this crispr