ID: 921279611

View in Genome Browser
Species Human (GRCh38)
Location 1:213552883-213552905
Sequence CAGTAGTGCTTGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921279611_921279615 -6 Left 921279611 1:213552883-213552905 CCTTCTACCTTCAAGCACTACTG No data
Right 921279615 1:213552900-213552922 CTACTGATCCACTGAGGTTTGGG No data
921279611_921279621 19 Left 921279611 1:213552883-213552905 CCTTCTACCTTCAAGCACTACTG No data
Right 921279621 1:213552925-213552947 ACGGGAGAGAGGTTGCAGTATGG No data
921279611_921279614 -7 Left 921279611 1:213552883-213552905 CCTTCTACCTTCAAGCACTACTG No data
Right 921279614 1:213552899-213552921 ACTACTGATCCACTGAGGTTTGG No data
921279611_921279617 1 Left 921279611 1:213552883-213552905 CCTTCTACCTTCAAGCACTACTG No data
Right 921279617 1:213552907-213552929 TCCACTGAGGTTTGGGCCACGGG No data
921279611_921279619 8 Left 921279611 1:213552883-213552905 CCTTCTACCTTCAAGCACTACTG No data
Right 921279619 1:213552914-213552936 AGGTTTGGGCCACGGGAGAGAGG No data
921279611_921279616 0 Left 921279611 1:213552883-213552905 CCTTCTACCTTCAAGCACTACTG No data
Right 921279616 1:213552906-213552928 ATCCACTGAGGTTTGGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921279611 Original CRISPR CAGTAGTGCTTGAAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr