ID: 921284769

View in Genome Browser
Species Human (GRCh38)
Location 1:213599506-213599528
Sequence CCCCCCACTGTTTGGAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921284769_921284774 18 Left 921284769 1:213599506-213599528 CCATATTTCCAAACAGTGGGGGG No data
Right 921284774 1:213599547-213599569 CCTTGAATTTTGTGTTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921284769 Original CRISPR CCCCCCACTGTTTGGAAATA TGG (reversed) Intergenic
No off target data available for this crispr