ID: 921289152

View in Genome Browser
Species Human (GRCh38)
Location 1:213638870-213638892
Sequence CCTTTTTTGCAGAAATTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921289152_921289157 -4 Left 921289152 1:213638870-213638892 CCTACCAATTTCTGCAAAAAAGG No data
Right 921289157 1:213638889-213638911 AAGGCATGCTGGAATTTGGTTGG No data
921289152_921289158 26 Left 921289152 1:213638870-213638892 CCTACCAATTTCTGCAAAAAAGG No data
Right 921289158 1:213638919-213638941 TTAAATCTATATCTCAATTTAGG No data
921289152_921289159 27 Left 921289152 1:213638870-213638892 CCTACCAATTTCTGCAAAAAAGG No data
Right 921289159 1:213638920-213638942 TAAATCTATATCTCAATTTAGGG No data
921289152_921289156 -8 Left 921289152 1:213638870-213638892 CCTACCAATTTCTGCAAAAAAGG No data
Right 921289156 1:213638885-213638907 AAAAAAGGCATGCTGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921289152 Original CRISPR CCTTTTTTGCAGAAATTGGT AGG (reversed) Intergenic
No off target data available for this crispr