ID: 921291488

View in Genome Browser
Species Human (GRCh38)
Location 1:213662029-213662051
Sequence ATTTATACCAGTAAGAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921291488_921291491 -8 Left 921291488 1:213662029-213662051 CCAAATCTCTTACTGGTATAAAT No data
Right 921291491 1:213662044-213662066 GTATAAATAAGGTATGTTGGAGG No data
921291488_921291493 12 Left 921291488 1:213662029-213662051 CCAAATCTCTTACTGGTATAAAT No data
Right 921291493 1:213662064-213662086 AGGGAGAACCCAATGTTTCTAGG No data
921291488_921291492 -7 Left 921291488 1:213662029-213662051 CCAAATCTCTTACTGGTATAAAT No data
Right 921291492 1:213662045-213662067 TATAAATAAGGTATGTTGGAGGG No data
921291488_921291496 22 Left 921291488 1:213662029-213662051 CCAAATCTCTTACTGGTATAAAT No data
Right 921291496 1:213662074-213662096 CAATGTTTCTAGGTCTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921291488 Original CRISPR ATTTATACCAGTAAGAGATT TGG (reversed) Intergenic
No off target data available for this crispr